Labshake search
Citations for New England Biolabs :
51 - 100 of 4878 citations for ± trans 1 Boc 4 4 pyridinyl pyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of Quick CIP (NEB, M0508S) was spiked into the reaction and incubated at 37°C for 30 minutes to dephosphorylate unincorporated dNTPs that may inhibit downstream processes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1 μl 10X NEB 4 buffer (NEB), 0.1 μl 10 mM dCTP and H2O ...
-
bioRxiv - Biophysics 2022Quote: ○ 4 μL Klenow Exo-enzyme (NEB #M0212S) μL
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x Apyrase buffer (NEB) and 1 µl of Apyrase (M0398S ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x r3.1 buffer (NEB), 2 µl of 100µM DTT and 1 µl of NudC (M0607S ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10X T4 Ligase Buffer (NEB, Cat #B0202S ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 µL 10x T4 ligase buffer (NEB), and water to 40 µL ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... for 1 hr at 37 °C and Proteinase K (4 U; P8107S, NEB, Ipswich, MA) for another 2 hr at 55 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ adapters with 4 terminal randomized nucleotides at the 3’ end was added using T4 RNA ligase (New England Biolabs, cat# M0204S). Ligation was carried out for 1 hour at 25°C with 20% PEG8000 ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Microbiology 2020Quote: ... 30 μL of 10x RE buffer 4 (NEB), 2 μL of exonuclease T7 (10,000 units/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 U of alkaline phosphatase from Biolabs (# M0290) and 5 mU of phosphodiesterase I from Sigma (# P3243-1VL ...
-
bioRxiv - Genetics 2020Quote: ... 4 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Genomics 2020Quote: ... [4 µl 5x NEB FirstStrand buffer (NEB; E7421AA), 0.25 µl SUPERase-In ...
-
bioRxiv - Neuroscience 2021Quote: ... and the 4 base restriction enzyme Mse1 (NEB) under standard double digest conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 μl of Calf intestinal alkaline phosphatase (NEB) was added to dephosphorylate the RNA for 15 min at 37 °C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 50% PEG-800 (New England Biolabs), 4 μl 10× T4 RNA ligase buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 total U of Proteinase K (NEB) at room temp for 10 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and 4 units of Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Genetics 2021Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μl 4× Template Switching RT buffer (NEB), 1 µl of 75 μM T7-TSO (5’-/5Biosg/ACTCTAATACGACTCACTATAGGGAGAGGGCrGrGrG-3’) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Molecular Biology 2023Quote: Proteinase solution: 4 μL proteinase K (NEB, P8107S) was added into 1 mL 0.1 M Tris-HCl 0.05 M EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 4 μL T4 PNK (New England BioLabs) in a 100 μL reaction for 2 hours at 37°C and purified using Micro-Bio P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10 mM ATP (NEB, Cat #P0756S), 40U (2 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL 10X rCutSmart buffer (NEB, B6004S) incubated at 72°C for 5 min) ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Genomics 2021Quote: ... exonuclease I (Exol) treatment was performed on all samples by adding 4 ul ExoI buffer and 4 ul ExoI (New England Biolabs, M0293L). Samples were incubated at 37 C for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genetics 2024Quote: ... 4) IDS-KO receiving 1 mg/kg idursulfase IV and nebulized idursulfase (KO-NEB, n = 5). The nebulized idursulfase was delivered as 167 µL of 2 mg/mL ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Microbiology 2023Quote: Verified amplicons were combined with the pMV306H integrative vector backbone at a ratio of 1:1 v/v and allowed to ligate overnight at 4°C with T4 DNA ligase (NEB). Ligation products were subsequently transformed into chemically competent DH5ɑ E.coli ...