Labshake search
Citations for New England Biolabs :
651 - 700 of 3392 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of 10x DNase I Buffer (New England Biolabs, #m0303s), 1 μL of rDNase I (ThermoFisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 µl of Gel loading dye without SDS (NEB, Ipswich, MA) were added to each reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Genomics 2024Quote: ... 0.25 μM of adapter and 2 μL of Quick ligase (NEB) for 20 minutes at 23°C in 40 μL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PNGase F (New England Biolabs catalog number P0704S), were combined with H2O to achieve a total volume of 10 µL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of Endo H (New England Biolabs catalog number P0702L), were combined with H2O to reach a total volume of 10 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 μL Phusion® HS Flex polymerase (2 U/μL - NEB), in a final volume of 40 μL ...
-
bioRxiv - Microbiology 2024Quote: ... and was loaded onto 2 mL of chitin resin (NEB; #S6651S) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was digested by adding 2 µL of PK (NEB) to the mixture and incubating at 45°C for 45 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µL of 10X RNase H Buffer (New England Biolabs, M0297S), and 1 µL of RNase H (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... 200 mM NaCl and 2 µl of proteinase K (NEB # P8107S) and incubated overnight at 65°C to lyse nuclei bound to the beads and DNA was extracted using phenol-chloroform and precipitated using glycogen ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of 10x reaction buffer (New England Biolabs, Ipswich, MA), 2 µl 0.1M DTT ...
-
bioRxiv - Biochemistry 2024Quote: gDNA was digested for 2 h with BamHI and XmnI (NEB). Multiplex 24 μL ddPCR reactions were prepared by mixing 12 μL of ddPCR supermix (no dUTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primers Set 1 and 2 (NEB, cat. no. E7335 and E7500). We proceeded by pulling the samples together ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were converted for sequencing with the NEBNext enzymatic methyl-seq kit (NEB) and sequenced at the University of Minnesota Genomics Center ...
-
bioRxiv - Molecular Biology 2024Quote: ... End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB). Conversion was performed identically to the amplicons ...
-
bioRxiv - Genomics 2023Quote: ... We used the NEB Next Enzymatic Methyl-seq Kit (New England Biolabs Cat.no. E7120S). Control DNA (CpG methylated pUC19 and unmethylated lambda ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Cell Biology 2024Quote: ... library preparation using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, E7120L) and 150 bp paired-end sequencing using the Illumina NovaSeq 6000 technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Handle 2 was then digested with Lambda Exonuclease (M0262, New England BioLabs), which removes nucleotides from linearized double-stranded DNA in the 5′ to 3′ direction ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 186 bp DNA (0.4 mg/ mL) in 1x NEBuffer 2 (NEB: B7002) was incubated with dATP (100 μM) ...
-
bioRxiv - Biochemistry 2020Quote: ... was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S) for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM of 7MeGpppA or GpppA RNA cap analogue (New England Biolabs), 10 μM adenosyl-methionine (AdoMet ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplifications were carried out using 2 x Q5 Master Mix (NEB), with cycling times and temperatures according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... and further passivated with 2 mg/ml Bovine serum albumin (BSA, NEB:B9000S) to prevent non-specific binding of proteins and DNA to the surface ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of total RNA was treated with DNase (New England Biolabs) and for the RT-qPCR experiment ...
-
bioRxiv - Genomics 2022Quote: ... followed by reverse-crosslinking with 2 ug/uL proteinase K (NEB, P8102), 1% SDS ...
-
Recurrent but short-lived duplications of centromeric proteins in holocentric Caenorhabditis speciesbioRxiv - Evolutionary Biology 2022Quote: ... RNA was treated with DNase I (New England Biolabs, 2 units/μl) at 37°C for 60 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... beads were resuspended in 50 μL of 1X NEBuffer 2 (NEB, B7002S) containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo- ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... We loaded genomic digests and 100ng of 2-log ladder (NEB N3200) onto a 1% agarose gel and subjected it to electrophoresis in 1XTTE overnight at 49V ...
-
bioRxiv - Immunology 2022Quote: ... a quantitative PCR reaction (10 µl 2 x PCR master mix (NEB), 1 x SYBR green (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... and cloning was performed using the Gibson Assembly 2× Master Mix (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and once with 2 bead volumes of 1X RNase H Buffer (NEB; 50mM Tris-HCl ...
-
bioRxiv - Genetics 2020Quote: ... using 2 μl of NEBNext dsDNA Fragmentase (New England Biolabs, cat. M0348), supplemented with 1 μl 200 mM MgCl2 ...
-
bioRxiv - Bioengineering 2020Quote: ... the SARS-CoV-2 RNA was obtained by in vitro transcription (NEB, HiScribe™ T7 High Yield RNA Synthesis Kit ...
-
bioRxiv - Developmental Biology 2021Quote: The DNA was then digested with 2 μL CutSmart Buffer (NEB, R0137L) and 1 μL Alul enzyme (NEB ...