Labshake search
Citations for New England Biolabs :
551 - 600 of 6184 citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome protected RNA fragments were 3’ dephosphorylated with T4 polynucleotide kinase (NEB) in 150 mM MES-NaOH pH 5.5 ...
-
bioRxiv - Genomics 2021Quote: ... and 150 μg chromatin was immunoprecipitated using 3 μg H3K18la (PTM Biolabs) overnight at 4°C with gentle rotation (20 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL DNase I (both New England Biolabs, Ipswich, MA, USA) was added to 30 μL of the mixture and incubated for 22 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ end dephosphorylation was performed with T4 polynucleotide kinase (New England Biolabs) before addition of a pre-adenylated linker using RNA ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3.5 µL of 3 U/µL T4 DNA Polymerase (New England Biolabs) was added to each sample ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2022Quote: About 3 μg plasmid was digested with 20 units SapI (NEB, R0569) and dephosphorylated with 3 units rSAP (NEB ...
-
bioRxiv - Physiology 2022Quote: ... and 3 U of DNAse I (catalog no. M0303, New England BioLabs) were added per ml of mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...
-
bioRxiv - Genetics 2020Quote: ... 3’-end RNA dephosphorylation was performed on beads with PNK (NEB M0201L) for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µl Ultra II End-prep enzyme mix (New England Biolabs). Samples were incubated at 20°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ adaptor was ligated to the cDNA using T4 ligase (NEB; M0202S). The cDNA was purified using Dynabeads myOne SILANE (life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ ends were dephosphorylated with T4 polynucleotide kinase (T4 PNK; NEB) in the following reaction mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Systems Biology 2023Quote: ... The second strand was synthesized using Klenow Fragment (3’ → 5’ exo-) (NEB). The dsDNA library was digested with Mlul-HF and Pad restriction enzymes (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 μL of Ultra-prep enzyme mix (New England Biolabs, UK), and completed with molecular biology grade water ...
-
bioRxiv - Cell Biology 2022Quote: ... these cells were treated with 3 µM SNAP-Cell TMR-Star (NEB) for 30 min at 37°C and washed in 10% FBS DMEM for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μl NEBNext Ultra II End Prep Enzyme Mix (NEB, E7546), incubated for 10 min at room temperature followed by 10 min at 65 °C ...
-
bioRxiv - Microbiology 2023Quote: ... using Phusion High Fidelity polymerase with HF buffer and 3% DMSO (NEB) under the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µg were DNAsed with DNase I treatment (New England Biolabs). RNA was directly ribodepleted with the riboPOOL kit (siTOOLs ...
-
bioRxiv - Genomics 2023Quote: ... 10 μL of Digestion-3 mix (5 U NotI-HF (NEB, R3189L) in 1X CutSmart buffer ...
-
bioRxiv - Biophysics 2023Quote: ... The sample was treated with 3 U/μL of micrococcal nuclease (NEB) in 50 mM HEPES-KOH pH 7.4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Digested DNA was treated with Klenow Fragment (3’→5’ exo-) (NEB, M0212) in a final volume of 250 µL of 1x NEBNext dA-tailing reaction buffer (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... catalog #70015-3) using T4 DNA ligase (New England Biolabs, catalog #M0202L). We then packaged ligation reactions using T7Select415-1b cloning kit (Novagen (EMD Millipore) ...
-
bioRxiv - Cell Biology 2023Quote: ... and for A-tailing with Klenow Fragment (3’->5’ exo–) (NEB; M0212). A biotinylated primer (ENDseq-adaptor-1 ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of NEBNext Ultra II End Prep Enzyme Mix (NEB) were added to each sample and mixed well by pipetting up and down ...
-
bioRxiv - Genomics 2024Quote: ... After dATP tailing with Klenow fragment (3’ è 5’ exo-; NEB # M0212), we performed ligation with Illumina Dual Index UMI adaptors (NEB # E7395 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a 3′ RNA adaptor was ligated with T4 RNA ligase (NEB) to synchronize with IP samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a 3′ DNA adaptor was ligated with T4 RNA ligase (NEB). qPCR was then used to determine the required amplification ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a 3′ RNA adaptor was ligated with T4 RNA ligase (NEB). 8% of IP and input samples were run on an analytical 4–12% PAGE gel ...
-
bioRxiv - Genetics 2024Quote: ... and subsequently A-tailed using Klenow Fragment (3’ -> 5’ Exo-; NEB, M0212M). For cloning purposes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...