Labshake search
Citations for New England Biolabs :
551 - 600 of 7642 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... the product was digested by Dpn1 for 4 hours (New England Biotechnologies, NEB). The PCR product was purified by gel purification (Zymo Research) ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 picomoles of hybridized DNA were mixed with USER3 mix (New England Biolabs) in ThermoPol buffer (20 mM Tris-HCl pH 8.8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of T4 DNA polymerase (3,000 U/ml, NEB, cat. no. M0203S) and 1 µl of the DNA polymerase I large (Klenow ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... or enzymatic methylation conversion (Enzymatic Methyl-seq Conversion Module, NEB Product #E7125L) to convert unmethylated cytosine to uracil ...
-
bioRxiv - Genomics 2024Quote: DNA was processed using the NEBNext Enzymatic Methyl-seq Kit (NEB, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Genomics 2020Quote: ... with 2 μl (5 U/μl) of Klenow fragment exo- (NEB) in a final volume of 55 μl by incubation at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Biophysics 2020Quote: ... and 7U/mL Klenow Fragment of DNA Polymerase I (3’-5 exo-) (NEB, M0212). Reactions were incubated at 37°C and incorporation of labeled dCMP was monitored by an acid precipitation assay ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Developmental Biology 2020Quote: ... act57B sequence: 5’-UCUUCCCCUC-3’ RNA oligonucleotides were end-labeled using T4 Kinase (NEB) with ATP [γ-32P]32 ...
-
bioRxiv - Genomics 2022Quote: ... the end-repaired DNA was mixed with Klenow Fragment (3′ → 5′ exo−) (NEB, #E6044A) in NEBNext dA-Tailing Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then 3’-end dephosphorylated and 5’-end phosphorylated using T4 polynucleotide kinase (NEB). tRNA library preparation used SuperScript™ IV following the QuantM-tRNA-seq protocol (Pinkard et al ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Plant Biology 2020Quote: ... 19 μL binding mixture containing 4 μL nuclear extracts and 5U Rnase H (NEB) or bovine pancreatic RNase A (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate GT10 5’_pSY45_pDS66_GT10cHA3 Flox_GT10 3’_pUC19 ...
-
bioRxiv - Cell Biology 2021Quote: ... the supernatant fraction was incubated with 4 ml amylose resin (New England Biolabs, E8021L) for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... then 4 μl of Q5 High-Fidelity 2X Master Mix (NEB, cat. no. M0541L) was added to each well ...
-
bioRxiv - Genomics 2022Quote: ... the DNA was added to 4.5 μL of 10X NEBuffer 4 (New England Biolabs), uridine diphosphate-6-azideglucose (UDP-6-N3-Glu ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate TbGT8 5’_BSDr_TbGT8 3’_pUC19 ...
-
bioRxiv - Genetics 2024Quote: ... 120 μL (4 mg/mL) streptavidin magnetic beads (NEB cat no. 50-812-660) were washed 3 times with 1 mL of lysis buffer then resuspended in 100 μL of complete lysis buffer and added to the hybridization mix and then incubated at 37 °C for an additional 30 min with mixing ...
-
bioRxiv - Microbiology 2023Quote: ... gene marker cassette by overnight ligation at 4 °C with T4 DNA Ligase (NEB). Overnight ligations were transformed into chemically competent DH5ɑ E ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation was performed overnight at 4 °C using T4 DNA ligase (New England Biolabs) followed by heat-inactivation for 10 min at 80 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μL template DNA and 0.4 units of Phusion High-Fidelity DNA Polymerase (NEB) (primer sequences provided in Table S3) ...
-
bioRxiv - Genomics 2023Quote: ... and 30% for overnight at 4 °C) with RNase inhibitor [New England Biolabs (NEB), M0314L ...
-
bioRxiv - Genomics 2022Quote: ... 16 µl RNA were mixed with 4 µl LunaScript master mix (NEB cat# E3010L), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Fragmented gDNA (4 μg) was digested with 20 U of RNase H (NEB #M0297S) for 6 hours to serve as a negative control ...
-
bioRxiv - Plant Biology 2023Quote: ... Degalactosylation was done with β1-4 galactosidase following the manufacturer’s instruction (New England Biolabs), and desalted and dried using Sep-Pak C18 cartridge and SpeedVac ...
-
bioRxiv - Developmental Biology 2023Quote: ... ∞ at 4 °C) using NEBNext HighFidelty 2x PCR Master Mix (New England Biolabs, M0541S) and Illumina i5 and i7 indices54 ...
-
bioRxiv - Microbiology 2024Quote: ... DNA not protected in viral capsids was digested with 4 U DNAse I (NEB) for 1.5 h at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...