Labshake search
Citations for Illumina :
1 - 39 of 39 citations for p5 Ligand for Dnak and and DnaJ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... A Nextera P5 (Illumina) and a custom-made P7 index primer (Supplementary Table S1 ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The first PCR aims to amplify genotyping fragments prior to sample indexing and uses P5 (binds the P5 Illumina sequencing handle ...
-
bioRxiv - Genetics 2023Quote: ... P5 and P7 adaptor sequences are from Illumina Adaptor Sequences Document # 1000000002694 v16.
-
bioRxiv - Genetics 2023Quote: ... P5 and P7 adaptor sequences are from Illumina Adaptor Sequences Document # 1000000002694 v16 ...
-
bioRxiv - Molecular Biology 2024Quote: ... along with the P5 and P7 adapters (Illumina Inc.) necessary for Miseq sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... The forward primer included a P5 sequence (for binding the Illumina flow cell) followed by a Illumina sequencing primer binding site ...
-
bioRxiv - Genomics 2019Quote: ... (i.e., P5 + i5 index + Read1 and P7 + i7 index + Read2; Fig. 1; Illumina Sequencing Dual-Indexed Libraries on the HiSeq System User Guide ...
-
bioRxiv - Neuroscience 2023Quote: ... The final libraries containing the P5 and P7 primers were generated by Illumina bridge amplification ...
-
bioRxiv - Immunology 2020Quote: ... and indexed using Nextera XT P5 and P7 index sequences (Illumina, San Diego, CA) for Illumina sequencing according to the manufacturer’s instructions (10 cycles) ...
-
bioRxiv - Developmental Biology 2023Quote: ... sequencing libraries were constructed by adding Illumina P5 and P7 primers (Illumina, Evry, France), as well as sample index via end repair ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina) were added to each well ...
-
bioRxiv - Genetics 2021Quote: ... and a unique combination of the dual barcoded primers P5 and P7 Nextera XT Index kit (Illumina #15055293) following the cycling conditions ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and a unique combination of the dual-barcoded primers P5 and P7 Nextera XT Index kit (Illumina #15055293). The cycling conditions were ...
-
bioRxiv - Microbiology 2021Quote: ... Second-round products were gel purified and indexed using Nextera XT P5 and P7 indices (Illumina, San Diego, CA). Gel-purified indexed libraries were quantified using the KAPA library quantification kit (Kapa Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... 600 pg of product were tagmented with barcoded N7 primers and P5-index-seq1 primers using the Nextera XT kit (Illumina). BRB-seq libraries were sequenced on a Novaseq 6000 paired-end with 28 x 91 reads.
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Genomics 2020Quote: The forward indexing primer sequence is - AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC and the reverse indexing primer sequence is - CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (where the bolded regions are the p5 and p7 flow cell adapters and [i5] and [i7] refer to the index sequence codes used by Illumina). The qPCR step starts with an initial denaturing step at 95 °C for 5 min followed by 35 cycles of denaturation (20s at 98 °C) ...
-
bioRxiv - Systems Biology 2021Quote: ... Fragments were amplified using a P5-SMART primer (Table S2) and an i7 indexed P7 adapter primers (Illumina, Table S2) at 0.75 µM in KAPA HiFi ready mix (PCR program table S4) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The bead-bound fragments are then amplified and sample indexed using P5 and RPI-X (binds the TruSeq Small RNA Read 2 handle and adds a sample index and P7 Illumina sequencing handle ...
-
bioRxiv - Cell Biology 2020Quote: To the cancer hot spot library P5 and P7 sequences were attached by PCR using the custom pBB9 primer and Nextera N701 (Illumina). Library was purified with 0.6x volume fraction AMPure beads ...
-
bioRxiv - Developmental Biology 2021Quote: ... libraries were also prepared using 50 ng of gDNA isolated from NaR P5 and 3D-RA DD25 cells by following the Nextera DNA Sample Preparation Guide (Illumina). The libraries were purified using the MinElute PCR purification kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used to optimize the cDNA amplicon size followed by adding P5 and P7 sample indexes (used in Illumina sequencers), and Illumina R2 sequence via processes of end repair ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Immunology 2023Quote: ... 200 pg of purified WTA products from each pool were subjected for library construction with custom designed New-P5-SMART-PCR primer using the Nextera XT DNA library preparation kit (Illumina) following the detailed protocol provided by the manufacture ...
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Developmental Biology 2024Quote: ... Another cleanup step with SPRIselect was performed before the Sample Index PCR when P5 and P7 sequences (for Illumina sequencing) and sample indices (to allow for multiplexing in the sequencer ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl each of P7 and P5 Nextera XT Index Kit v2 index primers (Illumina Catalogue numbers FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL each of P7 and P5 of Nextera XT Index Kit v2 index primers (catalogue No. FC-131-2001 to 2004; Illumina, Cambridge, UK) were also added to each well ...
-
bioRxiv - Biochemistry 2021Quote: ... Retromer ligands were identified by sequencing the final enriched cDNA using a MiSeq sequencer (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Genomics 2022Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...