Labshake search
Citations for Illumina :
1 - 4 of 4 citations for SP1 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resultant recombinants containing known donor barcodes and unknown recipient barcodes were sequenced by Illumina MiSeq platform ...
-
bioRxiv - Microbiology 2021Quote: The genomes of imipenem-resistant recombinants of M2 which had acquired blaOXA-23 were sequenced on a Novaseq instrument (Illumina, 2 × 150 bp paired-end ...