Labshake search
Citations for Illumina :
1 - 20 of 20 citations for Peptide T since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T cells were sequenced on a HiSeq 2500 or HiSeq 3000 sequencing system (Illumina paired-end multiplexing run ...
-
bioRxiv - Systems Biology 2022Quote: ... we sorted 500-1000 clonally expanded HLA-A2/YFV NS4b-specific CD8+ T cells directly into 22.5μl of ATAC-buffer (12.5μl 2× TD Buffer (Illumina), 0.5μl 1% Digitonin (Promega G9441) ...
-
bioRxiv - Immunology 2022Quote: ... and T cell mRNA targeted libraries were pooled together before sequencing on a NovaSeq6000 instrument (Illumina). For sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The abundance of the guide RNAs in the T = 0 and T10 replicates was determined by Illumina Next Generation Sequencing ...
-
bioRxiv - Immunology 2020Quote: ... we obtained publicly available CD8+ T-cell derived genome wide DNA methylation profiles (K450 Illumina DNA methylation arrays) from two previously published adult patient cohort ...
-
bioRxiv - Immunology 2021Quote: ... Peptides carried by the MCRs from sorted cells were amplified from cDNA by RT-PCR using the peptide flanking regions and sequenced on a miniSeq (Illumina). Sequences from the Illumina output files were trimmed ...
-
bioRxiv - Molecular Biology 2020Quote: ... The quality of the library peptides was assessed by Sanger sequencing of individual plaques from the packaging expansion and the clonal distribution assessed by Illumina sequencing.
-
bioRxiv - Genetics 2019Quote: Sequencing libraries were prepared using the truseq Nano DNA sample preparation kit (T FC-121-4001/4002, Illumina Inc) extracting 100 ng DNA for each sample ...
-
bioRxiv - Immunology 2024Quote: ... Live purified CD4+ T cells were processed using OMNI-ATAC protocol and libraries sequenced using NextSeq 500 sequencer (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using the configuration 28-8-98 on a single-index-paired-end run ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using 100 bp paired-end run at a depth of 65-100 million reads ...
-
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Genomics 2020Quote: Whole-genome DNA methylation measurement was performed on DNA from purified CD4+ T cells using Infinium MethylationEPIC BeadChip (Illumina 850K array) by the Center for Applied Genomics Genotyping Laboratory at the Children’s Hospital of Pennsylvania ...
-
bioRxiv - Genetics 2024Quote: The process of library construction involved the purification of messenger RNA from total RNA using magnetic beads attached to poly-T oligos (TruSeq RNA Sample Prep Kit v2, Illumina Inc.). Subsequently ...
-
bioRxiv - Genomics 2020Quote: ... was prepared from total RNA from a testicular tissue sample of one BSW bull homozygous for the mutant T-allele at Chr6:58373887 using the Illumina TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA). The library was sequenced using an Illumina NovaSeq6000 instrument ...