Labshake search
Citations for Illumina :
201 - 250 of 1589 citations for 3 Iodo 2 6 dimethyl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were diluted to 1.8nM and 2×300bp paired-end reads were generated on Illumina MiSeq 2 × 300 bp runs (Illumina, San Diego) by Source Bioscience.
-
bioRxiv - Microbiology 2024Quote: ... using 2 x 100-bp paired-end reads and 2 x 12-bp index reads with a 300-cycle kit (Illumina, 20012860).
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and day 3 RNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Microbiology 2023Quote: For array-based gene expression analysis: Analysis of gene expression was performed using the MouseWG-6 v2.0 array (Illumina), following quality testing of mRNA using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... scRNA-seq libraries were pooled at equimolar concentration and sequenced to saturation (median 6 reads/UMI) on an Illumina NextSeq 500 sequencer and using high-output 75 cycles v2.5 kits (Illumina), obtaining 483M reads in total ...
-
bioRxiv - Genomics 2024Quote: ... RPF library sequencing Fastq files (de-barcoded at the NHLBI core facility according to their 6-nt Illumina barcodes) were trimmed of their linkers and separated according to their 5-nt internal sample barcode using CUTADAPT ...
-
bioRxiv - Microbiology 2024Quote: Extracted nucleic acids were used for library preparation using the Nextera XT DNA library preparation kit with 15 amplification cycles (Illumina) and subjected to paired-end sequencing in a NextSeq 550 device with the read length of 150 bp at each end ...
-
bioRxiv - Microbiology 2024Quote: ... The Bam files were filtered for mappings to the Pf genome and analysed for nucleic acid variations using GATK (v4) [62] with the following series of commands: AddOrReplaceReadGroups (--RGPL ILLUMINA --RGPU MiSeq --RGSM $cell_id --RGLB $sample_id) ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation followed the TruSeq mRNA 2 (Illumina, USA) protocol and libraries were sequenced on an Illumina HiSeq 2500 platform (two lanes of 125 bp paired-end sequencing) ...
-
bioRxiv - Genomics 2021Quote: ... and sequenced with NovaSeq 6000 (2×150 bp) (Illumina). DNA was isolated from paired tumor-normal samples also using the AllPrep DNA/RNA/Protein Mini kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and TruSeq RNA Sample Preparation Kit version 2 (Illumina) according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing (HiSeq, 2 × 150bp paired end, Illumina®) were performed by GENEWIZ (South Plainfield ...
-
bioRxiv - Genomics 2022Quote: ... following manufacturer’s recommendations and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Genomics 2022Quote: ... refringens positive and negative samples were generated for RNAseq library construction and sequencing using the same protocol as described above and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Genomics 2020Quote: ... PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina; see Supplementary Table 2) were not processed through hybridization and sequencing ...
-
bioRxiv - Immunology 2022Quote: ... and RNA sequencing (Illumina HiSeq, 2 x 150 bp).
-
bioRxiv - Microbiology 2022Quote: ... by 2×150 Paired End (PE) configuration by Illumina HiSeq ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... read 2 - 91 cycles) performed with Nextseq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... After cluster generation on cBot 2 (Illumina, SanDiego, USA) using the HiSeq 3000/4000 SR Cluster Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Libraries (2×145 bp Illumina-compatible paired-end reads) were sequenced on a MiSeq® instrument (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA libraries with 2 % spiked-in PhiX control (Illumina) were sequenced at the 100-bp paired end on a P3 flow cell using an Illumina NextSeq2000 instrument at a sequencing depth of ∼80 K reads per cell ...
-
bioRxiv - Microbiology 2024Quote: ... Read 2 and Index Read—were obtained from Illumina MiSeq ...
-
bioRxiv - Cell Biology 2024Quote: ... The library was spiked with 2% PhiX library (Illumina) and sequenced on an iSeq 100 system.
-
bioRxiv - Microbiology 2020Quote: ... One microgram of gDNA with a DNA integrity number (DIN) of <=6 was used for library preparation using the TruSeq PCR-free library preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The paired-end reads of 150 bp were generated in an S4 flowcell with v1.5 sequencing chemistry on a NovaSeq-6 000 platform (Illumina Inc.). Read quality was checked by FastQC tool v0.11.9 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA-Seq libraries were prepared using Nextera XT library preparation kit with 700 pg DNA input per sample and 6:30 min tagmentation at 55 °C and barcoded using Nextera XT indexes (Illumina). RNA-Seq libraries were prepared using KAPA RNA HyperPrep kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... all indexed libraries were pooled with 6% PhiX spike-in DNA and sequenced using a MiSeq Reagent Nano Kit v2 (500 cycles) (Illumina) at the Fralin Genomics Sequencing Center.
-
bioRxiv - Cell Biology 2022Quote: ... Multiplexed libraries for the 1.5 h samples were generated using the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit and for the 6 h samples using TruSeqHT Stranded Total RNA Library Prep protocol (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Multiplexing of sgRNA challenge screens in BCBL-1 was performed utilizing 6-bp indexes and sequenced on a single lane of a HiSeq4000 (Illumina) using 50bp single-end (SE ...
-
bioRxiv - Plant Biology 2023Quote: Prepared libraries were pooled and diluted to 6 pM for TruSeq Paired End v4 DNA clustering on one single flow cell lane using a cBot device (Illumina). Final sequencing was carried out on an Illumina HiSeq 2500 platform using 126 ...
-
bioRxiv - Bioengineering 2023Quote: ... pair-end single index sequencing parameters were adjusted to 101/6/0/86 (as opposed to 74/6/0/86) to effectively utilize the capabilities of the NovaSeq 200 cycle reagent kit (Illumina). To demultiplex each sample and to generate the matrix of transcript counts in each cell ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were sequenced using the MiSeq 2×250 bp and HiSeq 2×150 bp paired-end read technology (Illumina, San Diego, CA, USA) as previously described [78] ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced across three lanes of a HiSeq or pooled for sequencing on a NovaSeq S1 using 2×75 (HiSeq) or 2×101 (NovaSeq) read lengths (Illumina, San Diego, CA). Variant calling and neoantigen prediction were performed as described previously (22,23).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...