Labshake search
Citations for Illumina :
51 - 100 of 317 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 5’ Illumina adapter (used in the Illumina small RNA kit) and a T7 promoter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 μl of NT buffer (Illumina, FC-121-1030) was added to each tube to neutralize the tagmentation reaction ...
-
bioRxiv - Genomics 2021Quote: ... 5-10% spike-in library (e.g. PhiX control from Illumina) must be added to the lane to balance the nucleotide distribution at the beginning of the forward and reversed reads ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Microbiology 2024Quote: ... 5-10% phiX spike-in (NextSeq PhiX Control Kit, Illumina) was added to the library to further support sequencing diversity and samples were run on the Illumina NextSeq 1000/2000 platform (single-end ...
-
bioRxiv - Biochemistry 2020Quote: ... the sample was spiked with 5% Phi-X control DNA (Illumina). The DNA was loaded onto the flow cell provided in the MiSeq Reagent kit v2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μl of Illumina Nextera DNA unique Dual Indexes (Illumina, 20027214) plus 25 μl NEBNext High-Fidelity 2X PCR Master Mix (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... The samples were spiked with 5 % Phi-X control DNA (Illumina) and loaded onto the flow cell and sequenced on and then applied onto an Illumina MiSeq instrument.
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were loaded at 6.0pM with 5% Phix control v3 (Illumina) added.
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ gene expression libraries were sequenced on a NextSeq 2000 (Illumina) aiming for 50,000 reads per cell ...
-
bioRxiv - Microbiology 2023Quote: ... Multiplexed samples were spiked with 5% PhiX Control v3 DNA (Illumina) to account for low diversity among sgRNA sequences ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μl of Tagment DNA Buffer (Illumina, FC-131-1096) and incubated at 55°C for 5 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of transposase enzyme (Illumina Tagment DNA TDE1 kit, 20034197). We also included additional components ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ul of Tn5 tagmentation mix (1X Tagment DNA buffer, Illumina; ATM mix ...
-
bioRxiv - Immunology 2021Quote: ... 12.5 µl TD buffer and 5 µl Tn5 transposase from Illumina (#15027865).
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Physiology 2024Quote: ... supplemented with 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Genetics 2024Quote: ... 800 ng of total RNAs were treated with 5’-polyphosphatase (Epicenter/Illumina) for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 cycles of amplification at PCR1 (addition of Illumina adapters and indexes), 12 cycles of amplification at PCR2 (final RNA-seq library amplification ...
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina FC-110-3001).
-
bioRxiv - Systems Biology 2023Quote: ... 62 °C for 5 min) using Nextera i5/i7 indexing primers (Illumina) and 2x KAPA HiFi HotStart ready-mix (KAPA Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina, FC-110-3001).
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were treated with 5 units RNaseI (ART-Seq, Epicenter/Illumina) per OD260 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL each of Nextera XT Index primers i5 and i7 (Illumina), 7 µL molecular grade water (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... The 5’gene expression libraries were sequenced in NextSeq or NovaSeq6000 sequencer (Illumina) using NextSeq 500/550 v2.5 sequencing reagent kit (read length ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... 5 µl nuclease and 2.5 µl Tn5 transposase enzyme (TDE1, Illumina, catalog # 15027865) and incubated for 28 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a loading sample concentration of 10pM and a 5% PhiX (Illumina, U.S.) spike-in ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pellet was resuspended in transposition solution containing 5 μL TDE1 (Illumina, 15027865) 25 μL 2x buffer (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were sequenced using the llumina NextSeq 550 platform with 5% PhiX (Illumina) spike-in ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing of 5’ gene expression libraries was performed on an Illumina NextSeq 2000 (Illumina) using P3 reagent kits (100 cycles) ...