Labshake search
Citations for Illumina :
501 - 550 of 595 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled to a final concentration of 5-10 ng/µL and sequenced on a NextSeq 500 (Illumina). The demultiplexed data was assembled and SNPs detected with Pilon software using reference genome sequences.84
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Immunology 2024Quote: ... the antibody barcode library was pooled at a ratio of 1:5 with the gene expression library and sequenced on a NextSeq 2000 (Illumina) to an average depth of 34,000 reads per cell.
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified with AMPure XP purification kit and Sixteen-plexed samples were pooled in approximately equimolar amounts of 5 nM and run in a single and double index reads on a Hiseq 4000 (Illumina).
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... groups was based on 5 μg of total RNA according to the manufacturer’s protocol using the Illumina HiScanSQ Instrument (Illumina, USA) and sequenced in the same flow cell as paired-end (2 × 100 bp) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified PCR products were pooled 1:1 and a 5% PhiX DNA spike-in was included and sequenced by Illumina HiSeq PE150 platform at Novogene ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The reverse transcription products (5 μL) were mixed with Eco™ Real-Time PCR System (Illumina, San Diego, CA, USA) and primers ...
-
bioRxiv - Systems Biology 2024Quote: ... The quality of each sequencing run was controlled by adding up to 5% of denatured and diluted down to 20pM PhiX (Illumina). Demultiplexing of the data by sample using the defined index pairs was performed automatically by Illumina BaseSpace.
-
bioRxiv - Developmental Biology 2024Quote: ... Gene expression and CRISPR libraries were prepared according to the CG000510 Chromium NextGEM Single Cell 5’ v2 CRISPR User Guide (Rev B, 10x Genomics) and sequenced on NextSeq and NovaSeq platforms (Illumina).
-
bioRxiv - Evolutionary Biology 2024Quote: ... Denatured libraries were diluted to a final concentration of 12 pM and combined with 5 % PhiX control (V3 cat# 15017666 from Illumina). Paired-end sequencing was performed on an Illumina MiSeq with 2×150 bp reads (MiSeq Reagent Kit v2 600-cycle ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were collected by centrifugation and subjected then to transposition reaction in 1x Tagment DNA buffer containing 5% Tn5 Transposase (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Samples were concentrated using a centrifugal evaporator Speed Vac® to a final volume of 5 μl and we started the TruSeq Small RNA Sample Preparation Kit (Illumina) protocol according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Extracted nuclei was processed for TN-5 mediated tagmentation using the Illumina Tagment DNA Enzyme and buffer kit (Nextera Illumina # 20034210) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ribosomal RNAs were depleted from 5 μg of total RNA of the sample by Ribo-Zero rRNA Removal Kit (Seed, Root) (Illumina®). After rRNA depletion ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Strand-specific library preparation (one library per sample) and paired-end (150 + 150 bp) Illumina sequencing (Illumina HiSeq 3000, 5 lanes) was then performed at the Finnish Functional Genomics Center (FFCG) ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Genomics 2020Quote: ... the fragmented amplicons were cleaned-up and amplified by 5 cycles of PCR using specific index adapters for Illumina sequencing (Nextera™ DNA CD Indexes, Illumina) (Supplementary Figure 1B) ...
-
bioRxiv - Developmental Biology 2022Quote: ... After centrifugation supernatant was used for RNA cytosolic fraction by adding to 1 ml of TRIZOL and isolated nuclei of CMs were incubated in 30 µl and of EC in 10 µl transposase mixture with 5% Nextera Tagment DNA Enzyme TDE (Illumina #15027916) in transposition buffer (20 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nextera libraries (5 replicates) were constructed from 0.8 ng of pre-amplified cleaned up cDNA using Nextera XT Kit (Illumina, Eindhoven, Netherlands). Index PCR was carried out using the custom P5 primer (P5NEXTPT5 ...
-
bioRxiv - Cell Biology 2024Quote: ... from islets was added to 50 μM first-strand RT primer (the sequence at the 5’ portion corresponds to primer P7 on the Illumina flowcell), 10 mM dNTP mix ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared from 700 ng total RNA using the TruSeq stranded mRNA library preparation kit (Cat# 20020594/5, Illumina Inc.) including polyA selection ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina, San Diego, California, USA). A blank extraction kit control ...
-
bioRxiv - Cell Biology 2024Quote: ... The second-strand cDNA was synthesized by adding 100 μM primer (the specific sequence at the 5′ portion corresponds to the primer for sequencing on the Illumina flowcell), 10× Taq DNA Polymerase Buffer ...
-
bioRxiv - Genomics 2023Quote: A 96-well plate pre-loaded with 5 μl of 500 nM pre-indexed Tn5 transposase per well (iTSM plate, kind gift of Illumina Inc.) was used to multiplex samples and perform barcoded transposition ...