Labshake search
Citations for Bioline :
1 - 38 of 38 citations for Recombinant Human X Linked Inhibitor of Apoptosis AVI tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 1.2 x Hifi Buffer (Bioline), 0.1 x SYBR Green (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5μl of 10 x Buffer (Bioline), 1.25μl of 50mM MgCl2 (Bioline) ...
-
bioRxiv - Microbiology 2020Quote: ... Human genomic DNA purchased from Bioline Australia (Cat No ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.16 U/μl RNase inhibitor (Bioline), 2 mM PMSF and cOmplete™ EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2022Quote: ... and maintained with Ribosafe RNAse Inhibitor (Bioline). Quality and quantity of RNA were assessed by Nanodrop (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... 40 units of Ribosafe RNAse Inhibitor (Bioline), and 4μl of 10X random primers (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNase inhibitor and Tetro reverse transcriptase (Bioline) was then added to heat denatured total RNA and cDNA was synthesized at 45°C for 1hr ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 40 units of Ribosafe RNAse Inhibitor (Bioline), and 4µl of 10X random primers (Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... and RNase inhibitor (10 U per reaction, Bioline). The resulting cDNA was subjected to real-time PCR in a Rotorgene 6000 (Corbett Life Science ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 0.16 U/μl Ribosafe RNase inhibitors (Bioline), 2 mM PMSF and cOmplete™ EDTA-free Protease Inhibitor Cocktail and lysed for 10 min on ice before refrigerated centrifugation at 17,000g for 5 min ...
-
bioRxiv - Genomics 2024Quote: ... in the presence of RiboSafe RNase Inhibitor (Bioline). Reverse transcription was conducted using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
bioRxiv - Microbiology 2019Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) enzyme ...
-
bioRxiv - Zoology 2022Quote: ... 0.5 μl BIO-X-ACT short DNA polymerase (Bioline Reagents Ltd, London, UK), 35.4 μl ddH2O ...
-
bioRxiv - Microbiology 2023Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) or Phusion (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A volume of GRASPS buffer A1 containing 0.16 U/μl RNase inhibitor (Bioline), 2 mM PMSF and cOmplete™ EDTA-free Protease Inhibitor Cocktail corresponding to approximately three times the volume of the cell pellet (600 μl ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... Agarose gels (1.5%) were prepared in 1 X TAE buffer (Astral Scientific) with 0.01% SYBR Safe DNA gel stain (Bioline). PCR products (5 µL ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of SFB in human tissue biopsies was performed using the MasterMix SensiFAST™ SYBR (BIOLINE) and 3 different primer sets ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reactions were performed in a total volume of 25 μl containing 12.5 μl 2 x MyTaq Red (Bioline, UK), 0.5 μl of each 10 μM primer stock ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.4 μM zebrafish genotyping primers (Extended Data Fig.5A, Table 2) and 1 x MyTaq Red DNA Polymerase (Bioline) according to the manufacturer’s protocol in a T100 thermal cycler ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of each forward primer 341F 5’-NNNNNNNNNNTCCTACGGGNGGCWGCAG and reverse primer 785R 5’-NNNNNNNNNNTGACTACHVGGGTATCTAAKCC in 20 μL volume of 1 x MyTaq buffer containing 1.5 units MyTaq DNA polymerase (Bioline) and 2 μl of BioStabII PCR Enhancer (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Microbiology 2023Quote: ... both samples were subjected to PCR with human GAPDH-specific primers41 and MyTaq polymerase (Bioline, Taunton, MA). Resulting PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR reactions were performed in 12 μL mixtures containing 1 x SensiFAST SYBR No-ROX mix (Bioline, Australia), 400 nM of each forward and reverse primer (Table 3 ...
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Microbiology 2019Quote: Plasmodium screening of human subjects was done in the regions surrounding Mbita using RDT kits (SD Bioline, UK). Microscopy was carried out on RDT-positive samples to confirm the presence of P ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... Cells were then lysed in hypotonic lysis buffer containing 0.16 U µl−1 Ribosafe RNase inhibitors (Bioline), 2 mM PMSF and SIGMAFAST Protease Inhibitor Cocktail tablets ...
-
bioRxiv - Cell Biology 2021Quote: ... The interaction between the protein products fused to the DNA binding and activation domains were analyzed by the activity of β-galactosidase by the cleavage of X-Gal (BIO-37035, Bioline, UK). For detecting the β-galactosidase activity overlaying of low melting agarose with X-Gal (over lay mix was prepared freshly) ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplification of each gene was performed in a 25-µL reaction mix using the Bio-X-Act short polymerase mix (Bioline, London, UK), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... the Methyl Indexed PCR was performed by mixing 4 µL of ligated DNA with x-Gen Dual combinatorial Indexes (IDT) (125 nM final concentration) and MyTaq RedMix (Bioline, BIO-25048) in a final volume of 40 µL ...
-
bioRxiv - Microbiology 2019Quote: ... for 14 hours at 37 °C in the presence of RiboSafe RNAse Inhibitor (Bioline, cat. number BIO-65028). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteinase K was added to a final concentration of 100 μg/ml (1.25 μl of stock at 20 mg/ml) with 0.16 U/μl Ribosafe RNase inhibitor (Bioline). The reactions were incubated at 37°C for 30 min after pulse vortex to digest the ribosomal proteins ...
-
bioRxiv - Genetics 2020Quote: ... 100 ng of sonicated template was used for T7-mediated IVT using the MEGAscript T7 Transcription Kit (ThermoFisher #AMB13345, supplemented with Ribosafe RNAse Inhibitor (Bioline #BIO-65028)) ...