Labshake search
Citations for Bioline :
1 - 10 of 10 citations for Mouse Anti Hepatitis B Virus Core Antibody M412 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: RNA was extracted from a total of 106 B cells purified from spleen or lymph nodes or 105 B cells sorted from the B:T co-cultures (72 h) using TRIsure™ (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: Total RNA was isolated from mouse tissues using TRIsure reagent (BIO-38033, Bioline Gmbh, Germany) and genomic DNA was digested using RNase-free DNase (rDNase ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of SFB in fecal mouse content was performed using the MasterMix SensiFAST™ SYBR (BIOLINE) and specific primer pair for_5‘-GACGCTGAGGCATGAGAGCAT-3‘ ...
-
bioRxiv - Molecular Biology 2023Quote: The total RNA from cell culture and mouse tissues were extracted using the TRIsure™ (Bioline, Cat.BIO-38033) reagent according to manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... cCREs and promoters were amplified from mouse genomic DNA (extracted fromE14TG2a mESCs, ATCC CRL-1821) by PCR using My-Taq Red mix (#BIO-25044; Bioline) in 384 well plates using automated liquid handling (Hamilton Microlab® STAR) ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA (gDNA) was isolated from mouse brains or dural meninges using the Isolate II Genomic DNA Kit (Bioline, BIO-52067) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Parasite genomic DNA was isolated from mouse peritoneal exudate cells and whole brain using the Isolate II Genomic DNA Kit (Bioline, BIO-52067). Prior to isolation ...
-
bioRxiv - Microbiology 2020Quote: ... The data presented in this study represents serological diagnosis using rapid test kit (SD Bioline dengue IgG/IgM antibody up to 2015; and after 2015, SD Bioline dengue duo (dengue NS1 Ag+ IgG/IgM), Korea ...