Labshake search
Citations for Bioline :
1 - 17 of 17 citations for Lamin A C Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed with 0.25-1 µg of RNA in a 20 µL total reaction volume using a random hexamer/oligo dT strand synthesis kit as per the manufacturer’s instructions (10 min at 25°C; 15 min at 42°C; 15 min at 48°C; SensiFast, Bioline). All oligonucleotide sequences are listed in Table 1.
-
bioRxiv - Microbiology 2020Quote: ... and cDNA synthesized with 0.25-1μg of RNA in a 20μL total reaction volume using a random hexamer/oligo dT strand synthesis kit in accordance with the manufacturer’s instructions (10 minutes at 25°C; 15 minutes at 42°C; 15 minutes at 48°C; SensiFast, Bioline). PCR amplification of HBV RNAs were performed using primers as previously described43 using a SYBR green real-time PCR protocol (qPCRBIO SyGreen ...
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Genomics 2020Quote: ... at 37°C for 30 min and then proteinase K digestion (Bioline, cat. #37084) for 2 h at 56 °C ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at 37°C and proteinase K (40 ug, Bioline BIO-37084) for 2 hours at 55°C ...
-
bioRxiv - Genomics 2019Quote: ... pool C was diluted 1,000-fold and 1.5 fmol were amplified using VELOCITY DNA polymerase (Bioline) with forward primer pool-FP1 and reverse primer pool-RP2 using the following PCR conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SensiMix SYBR Low-ROX Kit (Bioline; annealing temperature – 60°C) in a Lightcycler 480 384-well plate (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cross-linking was reversed by overnight incubation at 60°C with proteinase K (Bioline, Lot # BIO-37037). Then 3C libraries were purified by phenol-chloroform followed by chloroform extraction and ethanol-precipitated at −80°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... for 14 hours at 37 °C in the presence of RiboSafe RNAse Inhibitor (Bioline, cat. number BIO-65028). Next ...
-
bioRxiv - Genetics 2021Quote: ... and then digested with proteinase K (20 μg per sample at 56°C for 2 h; Bioline, cat. # 37084), and electrophoresed on a 1.5% agarose gel to verify that the majority of fragments were 100-400 bp in size ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was diluted in nuclease-free water and stored at −20°C until used in qPCR with the SensiFastTM SYBR® No-ROX kit (Bioline) and a Lightcycler® 480/1536 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Tissue pieces were digested at 4 °C on an orbital shaker-incubator at 200 × rpm (Bioline Global, New South Wales, Australia). After overnight digestion ...
-
bioRxiv - Microbiology 2020Quote: Bacterial cultures were grown in Luria Bertani (LB) broth for 18-24h at 37 °C and DNA was extracted using the Isolate II Genomic DNA Kit (Bioline, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2024Quote: ... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
bioRxiv - Cell Biology 2019Quote: ... The hPL-PIPC units were distributed into 45 mL aliquots and stored at −20°C in a freezer (Gram BioLine, Vojens, Denmark). In addition ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.