Labshake search
Citations for Bioline :
1 - 10 of 10 citations for Galectin 9 Human HEK293 GST since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... or GST were transfected in BL21 (DE3) Escherichia coli bacteria (Bioline). Bacterial starter culture was made by inoculation of 4 mL Luria broth with 10 μg/mL ampicillin ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Microbiology 2020Quote: ... Human genomic DNA purchased from Bioline Australia (Cat No ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of SFB in human tissue biopsies was performed using the MasterMix SensiFAST™ SYBR (BIOLINE) and 3 different primer sets ...
-
bioRxiv - Microbiology 2023Quote: ... both samples were subjected to PCR with human GAPDH-specific primers41 and MyTaq polymerase (Bioline, Taunton, MA). Resulting PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: Plasmodium screening of human subjects was done in the regions surrounding Mbita using RDT kits (SD Bioline, UK). Microscopy was carried out on RDT-positive samples to confirm the presence of P ...