Labshake search
Citations for Bioline :
1 - 25 of 25 citations for Fluorescein alkynylamino atp since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... using the SensiFAST SYBR & Fluorescein Kit (Bioline), on a Roche Lightcycler 96 ...
-
bioRxiv - Plant Biology 2022Quote: ... 12.5 μL 2x SensiMix SYBR& Fluorescein master mix (Bioline) and 10.25 μL nuclease-free water ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 μL of SensiFAST™ SYBR® & Fluorescein mix (Bioline), sterile DNA-free water and 5 ng of sample DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... SensiMix™ SYBR® & Fluorescein (2X) reagent (Bioline, QT615-05) was used for all RT-PCR reactions ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2x SensiMixTM SYBR & Fluorescein (Bioline, Cat no. QT615-05) in a 384 wells plate (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using SensiFAST SYBR & Fluorescein Kit (Bioline) as previously described (25,32) ...
-
bioRxiv - Plant Biology 2021Quote: ... and SensiMix™ SYBR® & Fluorescein Kit (Bioline, Catalog # QT615-05) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... amplification was performed using SensiFAST™ SYBR® & Fluorescein Kit (Bioline) and iQ5 Biorad system ...
-
bioRxiv - Cell Biology 2022Quote: ... employing SYBR Green chemistry (SensiMix™ SYBR® & Fluorescein Kit, Bioline). PCR reactions contained 2.0 μL diluted cDNA sample (corresponding to 7.5 ng total RNA ...
-
bioRxiv - Neuroscience 2022Quote: ... The qPCR assay was performed using sensiFAST SYBR and fluorescein kits (BioLine) and primers used in prior studies(Turgeon and Waring ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was carried out with SensiFAST(tm) SYBR® & Fluorescein Mix (BIOLINE) in a Bio-Rad iQ5 thermal cycler ...
-
bioRxiv - Molecular Biology 2020Quote: ... The qPCR analyses were performed with the SensiMix™ SYBR® & Fluorescein Kit (Bioline) on a LightCycler 480 (Roches) ...
-
bioRxiv - Immunology 2021Quote: ... and Arg1 genes was quantified by qPCR using Sensifast SYBR & Fluorescein kit (Bioline, London, UK). Gene expression was normalized to Gapdh expression ...
-
bioRxiv - Microbiology 2022Quote: ... then the number of genomes was quantified by SensiFAST™ SYBR® & Fluorescein Kit (Bioline) and CFX96 Touch Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 8 µl of primer pairs (0.5 µM each) and 10 µl of SensiMix SYBR & fluorescein mastermix (Bioline). The protocol included a 10 minute step at 95°C followed by 40 cycles at 95°C for 10 s and 60°C for 15 s ...
-
bioRxiv - Molecular Biology 2022Quote: ... Real- time PCR was performed using 2x SensiMix SYBR and Fluorescein Kit (Bioline, QT615-05, Luckenwalde, Germany), 20ng cDNA and pre-tested gene-specific primer sets (listed in Supplementary table 3) ...
-
bioRxiv - Microbiology 2024Quote: ... qRT-PCR analysis was performed on 50 ng of cDNA using the SensiFAST SYBR & Fluorescein kit (Bioline) with a Roche Lightcycler 96 ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR analysis was performed according to the manufacturer’s protocol (SensiMix™ SYBR® & Fluorescein Kit, Bioline) with a MyiQ Single-Color Real-Time PCR detection system (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... RT-qPCR was carried out using SensiMix™ SYBR® and Fluorescein kit (QT615-05; Bioline, London, United Kingdom). The following primers were used ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed in triplicate on 50 ng of cDNA using the SensiFAST SYBR & Fluorescein kit (Bioline) with a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real time-PCR (qRT-PCR) analysis was performed in triplicate on 50 ng cDNA using the SensiFAST SYBR & Fluorescein kit (Bioline) and a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative reverse-transcription PCR (qRT-PCR) with was performed with three technical replicates using 50 ng cDNA and the SensiFAST SYBR & Fluorescein Kit (Bioline) on a Roche Lightcycler 96 instrument ...
-
bioRxiv - Microbiology 2023Quote: ... was performed in technical triplicate with 50 ng of cDNA per reaction using the SensiFAST SYBR & Fluorescein Kit from Bioline, on a Roche Lightcycler 96 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).