Labshake search
Citations for ATTO-TEC GmbH :
1 - 43 of 43 citations for Recombinant Human TNFRSF17 protein Fc His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... His-Clathrin was labeled with Atto594 NHS-ester (ATTO-TEC, Sigma-Aldrich) according to a previously published protocol (41 ...
-
bioRxiv - Biophysics 2023Quote: His-FUS LC was labeled with Atto-488 or Atto-647 NHS-ester fluorescent dyes (ATTO-TEC, Sigma-Alrich). Labeling occurred at or near the N-terminus because only the N-terminus and a lysine at residue position 5 in the leader sequence preceding the N-terminal region hexa-histidine tag were expected to react with the NHS-functionalized dye ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins that were labeled with Atto488 maleimide (ATTO-TEC GmbH, Siegen, Germany) were titrated into the GUV suspension by 10 μM steps ...
-
bioRxiv - Biochemistry 2019Quote: Sensor proteins were labeled at cysteine with fluorophore-maleimide dyes from ATTO-TEC GmbH (Atto dyes ...
-
bioRxiv - Biophysics 2020Quote: ... our ssrA-tagged titin protein was reacted at room temperature with three equivalents of ATTO 575Q maleimide (ATTO-TEC; GMBH) for 30 min in buffer A supplemented with 5 mM Tris (pH 8.0) ...
-
bioRxiv - Biophysics 2022Quote: ... MCC-GGSC was labeled with Atto647N-maleimide (ATTO-TEC), purified by C18 column reversed phase HPLC ...
-
bioRxiv - Neuroscience 2023Quote: ... Tubulin was labeled using Atto633-NHS ester (ATTO-TEC) or CF640R (Biotium ...
-
bioRxiv - Biophysics 2021Quote: ... Tubulin was labeled using Atto-633 NHS-Ester (ATTO-TEC) and tetramethylrhodamine (TAMRA ...
-
bioRxiv - Biophysics 2022Quote: ATG3 was labeled with ATTO 565 NHS ester (ATTO-TEC). Briefly ...
-
bioRxiv - Biophysics 2023Quote: ... Atto488-labeled DOPE was obtained from ATTO-TEC (Siegen, Germany), and the lipid tracer DiD and other basic chemicals were purchased from Sigma-Aldrich (St ...
-
bioRxiv - Systems Biology 2023Quote: ... HDL particles were labeled with Atto 488 NHS (ATTO-TEC GmbH). In brief ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubulin was then labeled with either NHS-ester-ATTO 565 (ATTO-TEC), NHS-ester-ATTO 488 (ATTO-TEC ...
-
bioRxiv - Biophysics 2023Quote: Kinesin was labeled with ATTO 647N maleimide (AD 647N-41, ATTO-TEC) or Cyanine3B maleimide (19380 ...
-
bioRxiv - Cell Biology 2020Quote: ... Tubulin was labeled with fluorescent dyes (NHS-ester atto488 or atto565 (ATTO-TEC)) according to (55) ...
-
bioRxiv - Neuroscience 2019Quote: Fluorophore-labeled lipids (Atto488-DPPE and Atto550-DPPE) were obtained from ATTO-TEC. 3H-DPPC (3H-1,2-dipalmitoyl-sn-glycero-3-phosphocholine ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae ΔmurMN Lipid II was fluorescently labeled with ATTO488 NHS-ester (ATTO-TEC) (NHS-ester:Lipid II = 8:1 mole ratio ...
-
bioRxiv - Biophysics 2022Quote: ... : 880129C-10mg chloroforme) and ATTO 647N labeled DOPE (ATTO-TEC, AD 647N-161 dehydrated) were used ...
-
bioRxiv - Cell Biology 2022Quote: ... Confocal volume estimation was carried out by ten 1-min FCS measurements of 10 nM Atto488 (ATTO-TEC) in water ...
-
bioRxiv - Neuroscience 2022Quote: ... were covalently labeled with ATTO647N succinimidyl ester or ATTO594 succinimidyl ester dye (ATTO-TEC, Siegen, Germany) using manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4-fold (R2-myc-his; a gift from S. Oliveira) molar excess of NHS-ester (ATTO 425, ATTO 647N; ATTO-TEC GmbH ...
-
bioRxiv - Neuroscience 2024Quote: Recombinant monomeric αSyn (18 mg/ml) was incubated with ATTO-565-N-hydroxysuccinimidyl-ester (ATTO-TEC, Siegen Germany) in a sodium bicarbonate buffer according to the manufacturer’s instructions to fluorescently label αSyn ...
-
bioRxiv - Biophysics 2021Quote: ... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
bioRxiv - Cell Biology 2022Quote: L-a-phosphatidylcholine (EggPC) (Avanti, 840051C) and ATTO 647N labeled DOPE (ATTO-TEC, AD 647N-161 dehydrated) were used ...
-
bioRxiv - Biophysics 2023Quote: ... The Atto655-dyes labeled 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE-Atto655) were purchased from ATTO-TEC GmbH and dissolved in chloroform at a concentration of 0.01 mg/mL and 1 mg/mL for stock solution.
-
bioRxiv - Cell Biology 2020Quote: ... Frog tubulin was purified from Xenopus laevis egg extract and directly labeled with NHS-ester atto565 (ATTO-TEC) according to (56).
-
bioRxiv - Microbiology 2020Quote: ... Fiber FISH probes were pooled and labeled with ATTO 647N NHS-Ester (ATTO-TEC, Cat#: AD 647N-31), isopropanol precipitated and purified by HPLC as previously described81 ...
-
bioRxiv - Biochemistry 2021Quote: ... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine headgroup labeled with ATTO 488 (ATTO488-PE) was obtained from ATTO-TEC GmbH (Siegen ...
-
bioRxiv - Biochemistry 2020Quote: For smFRET experiments engineered cysteines of NBD1 constructs were labeled with ATTO488 and Alexa647 maleimide dyes (ATTO-TEC GmbH AD 488-41 and ThermoFisher A20347 ...
-
bioRxiv - Biochemistry 2020Quote: ... Microscope alignment was carried out using fluorescence correlation spectroscopy (FCS) on freely diffusing ATTO 488-CA and ATTO 655-CA (ATTO-TEC) and by connecting the detectors to a hardware correlator (ALV-5000/EPP ...
-
bioRxiv - Biochemistry 2022Quote: ... Microscope alignment was carried out using fluorescence correlation spectroscopy (FCS) on freely diffusing ATTO 488-CA and ATTO 655-CA (ATTO-TEC). Instrument response functions (IRFs ...
-
bioRxiv - Cell Biology 2023Quote: ... Confocal volume estimation was carried out by ten FCS-measurements of 1 min of 10 nM Atto488 (AD 488-21, ATTO-TEC) in double-distilled water ...
-
bioRxiv - Biophysics 2020Quote: GUVs were prepared as previously described with 0.5 % of the fluorescently labeled lipid Atto647N PtdEnt (ATTO-TEC GmbH, Siegen, Germany). 50 μl of the GUV suspension was carefully transferred into the microscopy chamber Nunc® Lab-Tek® II chambered coverglass (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Biophysics 2020Quote: ... and doped with 0.005 mol% of the red fluorescent lipid analog ATTO 633 DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine labeled with ATTO 633) obtained from ATTO-TEC GmbH (Siegen ...
-
bioRxiv - Cancer Biology 2023Quote: ... in which guide RNA contains crRNA with specific DNA target sequence and tracrRNA labeled with ATTO™ 550 (ATTO-TEC). Two crRNAs targeting SIX4 (ACAACTCCACTCGGAACTTC and CCTCGCACACGCAGGCGACA ...
-
bioRxiv - Biophysics 2024Quote: ... The lipid 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine labeled with Atto 647N (Atto-647N-DOPE) was obtained from ATTO-TEC GmbH ...
-
bioRxiv - Biophysics 2020Quote: ... 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine labeled with Atto 488 (DOPE-488; catalog number: AD 488-16) was purchased from ATTO-TEC GmbH ...
-
bioRxiv - Biophysics 2020Quote: ... The elastic PAA beads were fluorescently labeled by preparing an ATTO488-solution of 1 mg ATTO 488 NHS-Ester (ATTO-TEC) in 200 μL Dimethylsulfoxide and adding 6 μL ATTO488-solution to the PAA beads in PBS ...
-
bioRxiv - Bioengineering 2023Quote: Zein was fluorescently labeled by reacting its lysine residues with the fluorescent dye derivative Atto 488 NHS ester (ATTO-TEC, AD 488-31). Zein was dissolved in ethanol at 10 wt% and 50 mM Atto 488 NHS ester was added and stirred overnight in the dark.
-
bioRxiv - Biophysics 2022Quote: ... purified protein was dissolved in 2 M guanidine hydrochloride and the protein was allowed to react with Atto488 maleimide (ATTO-TEC, Germany) at 1:1 molar ratio at pH 6.8 ...
-
bioRxiv - Biophysics 2020Quote: The ENTH WT (C96A A155C) domain and the ENTH R114A (C96A A155C) were labeled with Atto488 maleimide (or Atto532 maleimide) (ATTO-TEC GmbH, Siegen, Germany) by cysteine modification ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,2-distearoyl-sn-glycero-3 phosphoethanolamine-N-[biotinyl(polyethylene glycol)-2000] (DSPE-PEG(2000)-Biotin) (Avanti, 880129C) and ATTO 647N labeled DOPE (ATTO-TEC, AD 647N-161 dehydrated) were used ...
-
bioRxiv - Microbiology 2021Quote: ... 50 µM of reduced protein was incubated with 100 µM ATTO 488-maleimide (ATTO-TEC) overnight at 4°C ...
-
bioRxiv - Pathology 2024Quote: ... 30 nmol of the protein monomer was incubated with 20 nmol of Atto 532-NHS ester (ATTO-TEC) for 2.5 h in the dark at room temperature ...