Labshake search
Citations for ATTO-TEC GmbH :
1 - 9 of 9 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... purified protein was dissolved in 2 M guanidine hydrochloride and the protein was allowed to react with Atto488 maleimide (ATTO-TEC, Germany) at 1:1 molar ratio at pH 6.8 ...
-
bioRxiv - Genomics 2023Quote: ... 2 μl of 0.5 mM 5’ amine-modified DNA probes (Integrated DNA technologies) is mixed with 1 μl of 10 mM ATTO488-NHS ester (ATTO-TEC AD 488-31), ATTO 643-NHS ester (ATTO-TEC AD 643-31 ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins that were labeled with Atto488 maleimide (ATTO-TEC GmbH, Siegen, Germany) were titrated into the GUV suspension by 10 μM steps ...
-
bioRxiv - Biochemistry 2019Quote: Sensor proteins were labeled at cysteine with fluorophore-maleimide dyes from ATTO-TEC GmbH (Atto dyes ...
-
bioRxiv - Microbiology 2021Quote: ... 50 µM of reduced protein was incubated with 100 µM ATTO 488-maleimide (ATTO-TEC) overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... For visualization either 0.05 mol% rhodamine B-labelled PE for FGF2 translocation assays or 0.002 mol% Atto-633 labelled dioleolyl-PE (Atto-633-DOPE, ATTO-TEC) for Dual-color FCS measurements was added ...
-
bioRxiv - Pathology 2024Quote: ... 30 nmol of the protein monomer was incubated with 20 nmol of Atto 532-NHS ester (ATTO-TEC) for 2.5 h in the dark at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... our ssrA-tagged titin protein was reacted at room temperature with three equivalents of ATTO 575Q maleimide (ATTO-TEC; GMBH) for 30 min in buffer A supplemented with 5 mM Tris (pH 8.0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... in which guide RNA contains crRNA with specific DNA target sequence and tracrRNA labeled with ATTO™ 550 (ATTO-TEC). Two crRNAs targeting SIX4 (ACAACTCCACTCGGAACTTC and CCTCGCACACGCAGGCGACA ...