Labshake search
Citations for ATTO-TEC GmbH :
1 - 3 of 3 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 2 μl of 0.5 mM 5’ amine-modified DNA probes (Integrated DNA technologies) is mixed with 1 μl of 10 mM ATTO488-NHS ester (ATTO-TEC AD 488-31), ATTO 643-NHS ester (ATTO-TEC AD 643-31 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in which guide RNA contains crRNA with specific DNA target sequence and tracrRNA labeled with ATTO™ 550 (ATTO-TEC). Two crRNAs targeting SIX4 (ACAACTCCACTCGGAACTTC and CCTCGCACACGCAGGCGACA ...
-
bioRxiv - Evolutionary Biology 2023Quote: The DNA and histones of cfChPs were fluorescently dually labelled with Platinum Bright™ 550 Red Nucleic Acid Labelling Kit (Kreatech Diagnostics, Cat # GLK-004) and ATTO 488 NHS-ester (ATTO-TEC GmbH, Cat # AD488-35), respectively ...