Labshake search
Citations for IDT DNA :
1 - 24 of 24 citations for Triclosan 13C12 99% 100 Ug Ml In Mtbe 2 4 4 Trichloro 2 Hydroxydiphenyl Ether since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The hybridization solution is as follows: 0.6ng/ml Cy5 labeled 2’-O-Me-(CCCCGG)5 RNA probe (IDT DNA Technologies, IA), 0.02% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... a 4 nucleotide chimeric substrate was commercially synthesized (IDT DNA Inc., Coralville, IA) with a 5’ carboxyfluorescein (FAM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA/RNA oligonucleotides (Supplementary File 2) were obtained from IDT DNA technologies.
-
bioRxiv - Biochemistry 2023Quote: ... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
bioRxiv - Microbiology 2020Quote: All plasmids are listed in Table 2 and oligonucleotides purchased from IDT DNA or Fisher used for their construction are listed in Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... and a domain linker ((G4S)4) between the variable heavy (VH) and variable light (VL) domains (Integrative DNA Technologies) (Figure 1B) ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli C41(DE3) cells were transformed with the SARS-CoV-2 pET-28a-nsp5 plasmid (IDT DNA). Single colonies were used to inoculate LB media supplemented with kanamycin (50 μg/mL) ...
-
bioRxiv - Developmental Biology 2023Quote: ... ordered at the 2 nmol or 10 nmol scales as Custom DsiRNAs with standard purification (IDT DNA Technologies), resuspended at 70-100 μM in 1X Bombyx injection buffer (pH 7.2 ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting plasmid pLN-PP1-HA3-loxP was further modified to target endogenous pfpp1 with HA3 and loxP by introduction of a 5’ homology region for the gene (HR1, 682 bp of genomic DNA sequence for exons 2 and 3) fused to a recodonized synthetic fragment (IDT DNA) for exons 4 and 5 ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantities of envelope (E) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies). Relative quantities of E gene were normalised to GAPDH mRNA levels (Applied Bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantity of nucleocapsid (N) RNA was measured using a SARS-CoV-2 (2019-nCoV) CDC qPCR N1 and control RNAseP probe set (IDT DNA Technologies). qPCR reactions were performed in duplicates with Taqman Universal PCR mix (Thermo ...
-
bioRxiv - Immunology 2020Quote: ... The relative quantities of nucleocapsid (N) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies).
-
bioRxiv - Microbiology 2022Quote: ... The relative quantities of envelope (E) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies). Relative quantities of E gene were normalized to GAPDH mRNA levels (Applied Bioscience ...
-
bioRxiv - Cell Biology 2024Quote: ... as previously described.10 Genetic correction of the pathological gene variant in the patient-derived iPSC line UMGi137-A clone 2 was performed using ribonucleoprotein-based CRISPR/Cas9 using crRNA/tracrRNA and Hifi SpCas9 (IDT DNA technologies) by targeting exon 15 of the LZTR1 gene ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and designed crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μL at 100 μM) and crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... and designed crRNA(s) for the target (IDT DNA, 2.75 μl at 100 μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Genomics 2020Quote: ... Lentiviral gRNA expression vectors were created by annealing two complementary oligonucleotides encoding gRNAs at 100 µM (IDT DNA) with sticky-ends and ligating annealed products into BsmB1 digested CROP-seq-opti vector using Golden Gate assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... The final injection mix containing Cas9 (IDT DNA, 0.5 ul at 10mg/ml), annealed crRNA and tracrRNA along with the repair template for the mutation and a co-CRISPR marker (unc-58 or dpy-10 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5 μl at 10 mg/ml), annealed crRNA and tracrRNA along with the repair template was incubated at 37°C for 15 minutes before the debris in the mix was pelleted (15 mins ...