Labshake search
Citations for IDT DNA :
1 - 15 of 15 citations for Trans Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%;1 D 97% 97% Chemical Purity since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... crRNA and trRNA (1:1) were complexed using touchdown polymerase chain reaction (PCR) (IDT DNA Technologies), and Cas9 3NLS protein (IDT DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and designed crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μL at 100 μM) and crRNA(s ...
-
bioRxiv - Microbiology 2020Quote: ... a synthetic fragment for a recodonized 3’ sequence of exon 1 followed by the artificial loxPint (IDT DNA), and a PCR-amplified fragment of the 5’ end of pfpp1 exon 2 (601 bp) ...
-
bioRxiv - Cell Biology 2022Quote: ... and designed crRNA(s) for the target (IDT DNA, 2.75 μl at 100 μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Molecular Biology 2022Quote: Electrophoretic mobility shift assays were performed with different competitor DNA (ssDNA-salmon sperm DNA) conditions than SELEX-seq using Fam-labled dsDNA probes were generated by annealing upper fam labeled oligos (IDT DNA, Supplementary table 1). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Primary probes for iterative smFISH were obtained as a pool that contained equimolar amounts of each of the 358 oligonucelotides from IDT DNA (Supplementary Table 1). Readout probes were obtained with 3’ amino moieties and coupled to either Texas Red or Cy5 and purifed by HPLC like smFISH probes ...
-
bioRxiv - Genomics 2020Quote: ... Lentiviral gRNA expression vectors were created by annealing two complementary oligonucleotides encoding gRNAs at 100 µM (IDT DNA) with sticky-ends and ligating annealed products into BsmB1 digested CROP-seq-opti vector using Golden Gate assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... The final injection mix containing Cas9 (IDT DNA, 0.5 ul at 10mg/ml), annealed crRNA and tracrRNA along with the repair template for the mutation and a co-CRISPR marker (unc-58 or dpy-10 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5 μl at 10 mg/ml), annealed crRNA and tracrRNA along with the repair template was incubated at 37°C for 15 minutes before the debris in the mix was pelleted (15 mins ...
-
bioRxiv - Genetics 2020Quote: ... The hybridization solution is as follows: 0.6ng/ml Cy5 labeled 2’-O-Me-(CCCCGG)5 RNA probe (IDT DNA Technologies, IA), 0.02% BSA ...