Labshake search
Citations for IDT DNA :
1 - 5 of 5 citations for Rabbit Anti Human IgG gamma chain Alexa Fluor 660 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... crRNA and trRNA (1:1) were complexed using touchdown polymerase chain reaction (PCR) (IDT DNA Technologies), and Cas9 3NLS protein (IDT DNA Technologies ...
-
bioRxiv - Biophysics 2024Quote: 601 DNA flanked by 20 bp of linker DNA (185 bp; 20-N-20) was amplified using polymerase chain reaction (PCR) using primers (IDT DNA) containing 20 bp overhangs ...
-
bioRxiv - Biophysics 2023Quote: ... all the DNA oligonucleotides were ordered with 5’-modification of Alexa Flour 488 fluorophore (from IDT DNA, Supplementary Table I).
-
Inhibition of major histocompatibility complex-I antigen presentation by sarbecovirus ORF7a proteinsbioRxiv - Microbiology 2022Quote: ... annotated in the viral genome (GenBank accession MN985325 (13)) and (14)) were human codon-optimized using GenSmartâ„¢ Codon Optimization and synthesized by IDT DNA Technologies as gBlocks ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...