Labshake search
Citations for IDT DNA :
1 - 17 of 17 citations for P N Nonylphenol 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: DNA sequences flanked by XhoI and NdeI restriction sites and encoding for N-terminal GST-tagged-SIX1 or N-terminal GST-tagged-SIX1-Q177R homeodomains were synthesized by Integrative DNA Technologies (IDT) as gBlocks (Supplemental Table 2) ...
-
bioRxiv - Microbiology 2019Quote: ... The ermE*p was synthesized as a double stranded BioBrick gBlock (IDT DNA). Snoa123 was amplified via polymerase chain reaction from S ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μl at 100 μM) and designed crRNA(s ...
-
bioRxiv - Cell Biology 2022Quote: ... tracrRNA (IDT DNA, 0.5 μL at 100 μM) and crRNA(s ...
-
bioRxiv - Molecular Biology 2023Quote: ... the full-length codon optimized gene with N-terminal 6x-His-sequnce and NdeI-XhoI sites was synthesized (IDT DNA Inc.) (Table S2) ...
-
bioRxiv - Biophysics 2024Quote: 601 DNA flanked by 20 bp of linker DNA (185 bp; 20-N-20) was amplified using polymerase chain reaction (PCR) using primers (IDT DNA) containing 20 bp overhangs ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantity of nucleocapsid (N) RNA was measured using a SARS-CoV-2 (2019-nCoV) CDC qPCR N1 and control RNAseP probe set (IDT DNA Technologies). qPCR reactions were performed in duplicates with Taqman Universal PCR mix (Thermo ...
-
bioRxiv - Immunology 2020Quote: ... The relative quantities of nucleocapsid (N) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies).
-
bioRxiv - Cell Biology 2022Quote: ... and designed crRNA(s) for the target (IDT DNA, 2.75 μl at 100 μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Genomics 2020Quote: ... Lentiviral gRNA expression vectors were created by annealing two complementary oligonucleotides encoding gRNAs at 100 µM (IDT DNA) with sticky-ends and ligating annealed products into BsmB1 digested CROP-seq-opti vector using Golden Gate assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... The final injection mix containing Cas9 (IDT DNA, 0.5 ul at 10mg/ml), annealed crRNA and tracrRNA along with the repair template for the mutation and a co-CRISPR marker (unc-58 or dpy-10 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5 μl at 10 mg/ml), annealed crRNA and tracrRNA along with the repair template was incubated at 37°C for 15 minutes before the debris in the mix was pelleted (15 mins ...
-
bioRxiv - Genetics 2020Quote: ... The hybridization solution is as follows: 0.6ng/ml Cy5 labeled 2’-O-Me-(CCCCGG)5 RNA probe (IDT DNA Technologies, IA), 0.02% BSA ...