Labshake search
Citations for IDT DNA :
1 - 8 of 8 citations for Mouse Anti MERS Coronavirus Spike S1 Antibody 3872 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Primers (Table S1) synthesized by Integrative DNA Technologies were designed that amplified on either side of the antibiotic resistance cassette that was to be removed ...
-
bioRxiv - Genetics 2021Quote: ... and an siRNA for Lig4 (IDT DNA, Supplement Table S1).
-
bioRxiv - Biochemistry 2020Quote: ... coli MBP (malE) was obtained as a gBlock (IDT DNA, Table S1). BsaI sites were added to ends by PCR with complementary overhangs for golden gate cloning into pATT-Dest (Addgene plasmid #79770 ...
-
bioRxiv - Microbiology 2022Quote: ... linkers encoding the protospacer motif of three gRNAs (Table S1) were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3 ...
-
bioRxiv - Microbiology 2020Quote: ... appended with regions of the target spike backbone to facilitate Infusion cloning and synthesized as double stranded DNA fragments (IDT DNA). SARS-CoV ...
-
bioRxiv - Immunology 2024Quote: ... 65 pmol of sgRNA targeting mouse Pdl1 (IDT DNA) and 30 pmol of S.p ...
-
bioRxiv - Immunology 2024Quote: ... Pvrig KO NK cells were isolated from spleens of Pvrig KO mice and transfected with two sgRNAs targeting mouse Tigit or Cd96 (IDT DNA) using Cas9-gRNA RNP-directed gene deletion on day 5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...