Labshake search
Citations for IDT DNA :
1 - 8 of 8 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 65 pmol of sgRNA targeting mouse Pdl1 (IDT DNA) and 30 pmol of S.p ...
-
Inhibition of major histocompatibility complex-I antigen presentation by sarbecovirus ORF7a proteinsbioRxiv - Microbiology 2022Quote: ... annotated in the viral genome (GenBank accession MN985325 (13)) and (14)) were human codon-optimized using GenSmart™ Codon Optimization and synthesized by IDT DNA Technologies as gBlocks ...
-
bioRxiv - Immunology 2024Quote: ... Pvrig KO NK cells were isolated from spleens of Pvrig KO mice and transfected with two sgRNAs targeting mouse Tigit or Cd96 (IDT DNA) using Cas9-gRNA RNP-directed gene deletion on day 5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... crRNA and trRNA (1:1) were complexed using touchdown polymerase chain reaction (PCR) (IDT DNA Technologies), and Cas9 3NLS protein (IDT DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
bioRxiv - Microbiology 2020Quote: ... a synthetic fragment for a recodonized 3’ sequence of exon 1 followed by the artificial loxPint (IDT DNA), and a PCR-amplified fragment of the 5’ end of pfpp1 exon 2 (601 bp) ...
-
bioRxiv - Molecular Biology 2022Quote: Electrophoretic mobility shift assays were performed with different competitor DNA (ssDNA-salmon sperm DNA) conditions than SELEX-seq using Fam-labled dsDNA probes were generated by annealing upper fam labeled oligos (IDT DNA, Supplementary table 1). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Primary probes for iterative smFISH were obtained as a pool that contained equimolar amounts of each of the 358 oligonucelotides from IDT DNA (Supplementary Table 1). Readout probes were obtained with 3’ amino moieties and coupled to either Texas Red or Cy5 and purifed by HPLC like smFISH probes ...