Labshake search
Citations for IDT DNA :
1 - 8 of 8 citations for Mouse Anti Hepatitis B Virus Core Protein Antibody 1824 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and Cas9 3NLS protein (IDT DNA Technologies) was added to make functional ribonucleoprotein (RNP) ...
-
bioRxiv - Microbiology 2021Quote: ... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ...
-
bioRxiv - Immunology 2024Quote: ... 65 pmol of sgRNA targeting mouse Pdl1 (IDT DNA) and 30 pmol of S.p ...
-
bioRxiv - Molecular Biology 2024Quote: ... Spliceosome proteins for fusion experiments were ordered as eBlocks from IDT DNA. An expression backbone originally containing wild-type Cas7-11 (pDF0506 ...
-
bioRxiv - Microbiology 2020Quote: ... A bacteria-codon optimized gBlock for the truncated protein was produced by IDT DNA Technologies and cloned into a pET28a bacterial expression with a C-terminal 6xHis tag using the NEBuilder Assembly Kit (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... The RNP was made by incubating gRNA and High Fidelity Cas9 protein (Integrative DNA Technologies, USA) at a molar ratio of 1:2 at 37 °C for 15 min ...
-
bioRxiv - Immunology 2024Quote: ... Pvrig KO NK cells were isolated from spleens of Pvrig KO mice and transfected with two sgRNAs targeting mouse Tigit or Cd96 (IDT DNA) using Cas9-gRNA RNP-directed gene deletion on day 5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...