Labshake search
Citations for IDT DNA :
1 - 4 of 4 citations for Mouse Anti CMV Glycoprotein B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ...
-
bioRxiv - Immunology 2024Quote: ... 65 pmol of sgRNA targeting mouse Pdl1 (IDT DNA) and 30 pmol of S.p ...
-
bioRxiv - Immunology 2024Quote: ... Pvrig KO NK cells were isolated from spleens of Pvrig KO mice and transfected with two sgRNAs targeting mouse Tigit or Cd96 (IDT DNA) using Cas9-gRNA RNP-directed gene deletion on day 5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...