Labshake search
Citations for IDT DNA :
1 - 6 of 6 citations for L Phenylalanine N T Boc 13C9 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: DNA sequences flanked by XhoI and NdeI restriction sites and encoding for N-terminal GST-tagged-SIX1 or N-terminal GST-tagged-SIX1-Q177R homeodomains were synthesized by Integrative DNA Technologies (IDT) as gBlocks (Supplemental Table 2) ...
-
bioRxiv - Genomics 2023Quote: ... 25 µM annealed ChAR-seq bridge (top strand: /5rApp/AANNNAAACCGGCGTCCAAGGATCTTTAATTAAGTCGCAG/3SpC3/; bottom strand: /5Phos/GATCTGCGACTTAATTAAAGATCCTTGGACGCCGG/iBiodT/T; individual strands ordered from IDT DNA) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the full-length codon optimized gene with N-terminal 6x-His-sequnce and NdeI-XhoI sites was synthesized (IDT DNA Inc.) (Table S2) ...
-
bioRxiv - Biophysics 2024Quote: 601 DNA flanked by 20 bp of linker DNA (185 bp; 20-N-20) was amplified using polymerase chain reaction (PCR) using primers (IDT DNA) containing 20 bp overhangs ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantity of nucleocapsid (N) RNA was measured using a SARS-CoV-2 (2019-nCoV) CDC qPCR N1 and control RNAseP probe set (IDT DNA Technologies). qPCR reactions were performed in duplicates with Taqman Universal PCR mix (Thermo ...
-
bioRxiv - Immunology 2020Quote: ... The relative quantities of nucleocapsid (N) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies).