Labshake search
Citations for IDT DNA :
1 - 2 of 2 citations for Goat Anti Human IgG Fc Alkaline Phosphatase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Inhibition of major histocompatibility complex-I antigen presentation by sarbecovirus ORF7a proteinsbioRxiv - Microbiology 2022Quote: ... annotated in the viral genome (GenBank accession MN985325 (13)) and (14)) were human codon-optimized using GenSmartâ„¢ Codon Optimization and synthesized by IDT DNA Technologies as gBlocks ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...