Labshake search
Citations for IDT DNA :
1 - 9 of 9 citations for Cow T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... crRNA and trRNA (1:1) were complexed using touchdown polymerase chain reaction (PCR) (IDT DNA Technologies), and Cas9 3NLS protein (IDT DNA Technologies ...
-
bioRxiv - Biophysics 2024Quote: 601 DNA flanked by 20 bp of linker DNA (185 bp; 20-N-20) was amplified using polymerase chain reaction (PCR) using primers (IDT DNA) containing 20 bp overhangs ...
-
bioRxiv - Genomics 2023Quote: ... 25 µM annealed ChAR-seq bridge (top strand: /5rApp/AANNNAAACCGGCGTCCAAGGATCTTTAATTAAGTCGCAG/3SpC3/; bottom strand: /5Phos/GATCTGCGACTTAATTAAAGATCCTTGGACGCCGG/iBiodT/T; individual strands ordered from IDT DNA) ...
-
bioRxiv - Molecular Biology 2020Quote: The RNA samples were treated with PowerCheck 2019-nCoV Real-time PCR Kit (Kogene biotech, Seoul, Korea), COVID-19 PCR Diatheva Detection Kit (Diatheva, Cartoceto, Italy) and 2019 nCoV CDC EUA KIT (IDT DNA, Coralville, Iowa, USA) mixed with FastGene Probe One Step Mix (Nippon Genetics Europe Gmbh ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription was performed using the SuperScript II RT kit (Integrative DNA Technologies) with total RNA (1 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were generated using the Alt-R CRISPR-Cas9 System (IDT DNA Technologies) following the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Immunology 2023Quote: ... Control cells were transfected with the nuclease duplex buffer from IDT DNA (USA) instead of crRNA.
-
bioRxiv - Molecular Biology 2020Quote: ... coli C41(DE3) cells were transformed with the SARS-CoV-2 pET-28a-nsp5 plasmid (IDT DNA). Single colonies were used to inoculate LB media supplemented with kanamycin (50 μg/mL) ...
-
bioRxiv - Immunology 2024Quote: ... Pvrig KO NK cells were isolated from spleens of Pvrig KO mice and transfected with two sgRNAs targeting mouse Tigit or Cd96 (IDT DNA) using Cas9-gRNA RNP-directed gene deletion on day 5 ...