Labshake search
Citations for IDT DNA :
1 - 4 of 4 citations for Anti Syndecan 4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... a 4 nucleotide chimeric substrate was commercially synthesized (IDT DNA Inc., Coralville, IA) with a 5’ carboxyfluorescein (FAM ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
bioRxiv - Microbiology 2020Quote: ... and a domain linker ((G4S)4) between the variable heavy (VH) and variable light (VL) domains (Integrative DNA Technologies) (Figure 1B) ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...