Labshake search
Citations for IDT DNA :
1 - 3 of 3 citations for Anti Flag Affinity Gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 6xHis-SUMO-XCL1(CC3)-FLAG was ordered as a gBlock from IDT DNA Technologies and cloned in digested pET28a(+ ...
-
bioRxiv - Molecular Biology 2021Quote: ... we first constructed a pCDNA-FLAG plasmid by inserting a 5xFLAG sequence (synthesized as a gBlock by IDT DNA) into the HindIII/XbaI site of pCDNA3 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...