Labshake search
Citations for IDT DNA :
1 - 20 of 20 citations for 7 CHLORO 3 PHENYL PYRAZOLO 1 5 A PYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... (pan)Ifna (Forward: 5’-CTTCCACAGGATCACTGTGTACCT-3’; Reverse: 5’-TTCTGCTC TGACCACCTCCC-3’; Probe: 5’-AGAGAGAAGAAACACAGCCC CTGTGCC-3’; IDT DNA)(Samuel & Diamond ...
-
bioRxiv - Immunology 2020Quote: ... 160 ng DNA was quantified for MCMV IE1 (Forward: 5’-CCCTCTCCTAACTCTCCCTTT-3’; Reverse: 5’-TGGTGCTCTTTTCCCGTG −3’; Probe: 5’-TCTCTTGCCCCGTCCTGAAAACC-3’; IDT DNA) and host Actb (Forward ...
-
bioRxiv - Biochemistry 2021Quote: RNA-ARE probes were designed from the Fgf21-3’UTR ARE sequence and synthesized with 5’-biotin end-labelling (IDT DNA technologies). HEK293 cells were transfected with the ZFP36L1 expression plasmid (pcDNA 3.1+/C-(K)-DYK Zfp36l1 ...
-
bioRxiv - Microbiology 2020Quote: ... a synthetic fragment for a recodonized 3’ sequence of exon 1 followed by the artificial loxPint (IDT DNA), and a PCR-amplified fragment of the 5’ end of pfpp1 exon 2 (601 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... The 5’6-FAM/dArUdAdA/3’-TAMRA oligonucleotide was purchased from IDT DNA Inc (Coralville ...
-
bioRxiv - Bioengineering 2023Quote: ... at a final concentration of 3 μM and electroporation enhancer (IDT DNA) at a final concentration of 30 μM were added to the gRNA mix ...
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Biophysics 2022Quote: DNA sequences with 5’ lipids were custom ordered from IDT DNA. DNA Sequence ‘C’ used to tether liposomes is /5DPPEK/TA GTA TTC AAC ATT TCC GTG TCGA and complementary DNA sequence ‘D’ incorporated in viral particles is /5DPPEK/TT TTT TTT TTT TTT TTT TTTTTT TTC GAC ACG GAA ATG TTG AAT ACTA with T24 linker as previously used (21) ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
bioRxiv - Biophysics 2023Quote: ... DNA templates were generated by PCR using a 5’-ATTO647-funtionalized (IDT DNA) 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843 ...
-
bioRxiv - Microbiology 2021Quote: ... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting plasmid pLN-PP1-HA3-loxP was further modified to target endogenous pfpp1 with HA3 and loxP by introduction of a 5’ homology region for the gene (HR1, 682 bp of genomic DNA sequence for exons 2 and 3) fused to a recodonized synthetic fragment (IDT DNA) for exons 4 and 5 ...
-
bioRxiv - Immunology 2021Quote: ... 0.7 µl template switch oligo (TSO) (10 µM, f/c 200 nM, IDT DNA; #110, Supplementary table 5), nuclease-free water till 35 µl and subsequent incubation at 42°C for 2 hours ...
-
bioRxiv - Biophysics 2023Quote: ... all the DNA oligonucleotides were ordered with 5’-modification of Alexa Flour 488 fluorophore (from IDT DNA, Supplementary Table I).
-
bioRxiv - Genetics 2020Quote: ... The hybridization solution is as follows: 0.6ng/ml Cy5 labeled 2’-O-Me-(CCCCGG)5 RNA probe (IDT DNA Technologies, IA), 0.02% BSA ...
-
bioRxiv - Biophysics 2023Quote: ... 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843) and a 5’-biotinylated (IDT DNA) 3’ primer with linker DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... crRNA and trRNA (1:1) were complexed using touchdown polymerase chain reaction (PCR) (IDT DNA Technologies), and Cas9 3NLS protein (IDT DNA Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: Electrophoretic mobility shift assays were performed with different competitor DNA (ssDNA-salmon sperm DNA) conditions than SELEX-seq using Fam-labled dsDNA probes were generated by annealing upper fam labeled oligos (IDT DNA, Supplementary table 1). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Primary probes for iterative smFISH were obtained as a pool that contained equimolar amounts of each of the 358 oligonucelotides from IDT DNA (Supplementary Table 1). Readout probes were obtained with 3’ amino moieties and coupled to either Texas Red or Cy5 and purifed by HPLC like smFISH probes ...