Labshake search
Citations for IDT DNA :
1 - 33 of 33 citations for 7 tert butoxycarbonyl 5 6 7 8 tetrahydro 1 2 4 triazolo 4 3 a pyrazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... (pan)Ifna (Forward: 5’-CTTCCACAGGATCACTGTGTACCT-3’; Reverse: 5’-TTCTGCTC TGACCACCTCCC-3’; Probe: 5’-AGAGAGAAGAAACACAGCCC CTGTGCC-3’; IDT DNA)(Samuel & Diamond ...
-
bioRxiv - Immunology 2020Quote: ... 160 ng DNA was quantified for MCMV IE1 (Forward: 5’-CCCTCTCCTAACTCTCCCTTT-3’; Reverse: 5’-TGGTGCTCTTTTCCCGTG −3’; Probe: 5’-TCTCTTGCCCCGTCCTGAAAACC-3’; IDT DNA) and host Actb (Forward ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting plasmid pLN-PP1-HA3-loxP was further modified to target endogenous pfpp1 with HA3 and loxP by introduction of a 5’ homology region for the gene (HR1, 682 bp of genomic DNA sequence for exons 2 and 3) fused to a recodonized synthetic fragment (IDT DNA) for exons 4 and 5 ...
-
bioRxiv - Biochemistry 2021Quote: RNA-ARE probes were designed from the Fgf21-3’UTR ARE sequence and synthesized with 5’-biotin end-labelling (IDT DNA technologies). HEK293 cells were transfected with the ZFP36L1 expression plasmid (pcDNA 3.1+/C-(K)-DYK Zfp36l1 ...
-
bioRxiv - Microbiology 2020Quote: ... a synthetic fragment for a recodonized 3’ sequence of exon 1 followed by the artificial loxPint (IDT DNA), and a PCR-amplified fragment of the 5’ end of pfpp1 exon 2 (601 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... The 5’6-FAM/dArUdAdA/3’-TAMRA oligonucleotide was purchased from IDT DNA Inc (Coralville ...
-
bioRxiv - Bioengineering 2023Quote: ... at a final concentration of 3 μM and electroporation enhancer (IDT DNA) at a final concentration of 30 μM were added to the gRNA mix ...
-
bioRxiv - Microbiology 2021Quote: ... a 4 nucleotide chimeric substrate was commercially synthesized (IDT DNA Inc., Coralville, IA) with a 5’ carboxyfluorescein (FAM ...
-
bioRxiv - Microbiology 2021Quote: ... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ...
-
bioRxiv - Microbiology 2020Quote: ... and a domain linker ((G4S)4) between the variable heavy (VH) and variable light (VL) domains (Integrative DNA Technologies) (Figure 1B) ...
-
bioRxiv - Genetics 2020Quote: ... The hybridization solution is as follows: 0.6ng/ml Cy5 labeled 2’-O-Me-(CCCCGG)5 RNA probe (IDT DNA Technologies, IA), 0.02% BSA ...
-
bioRxiv - Cell Biology 2020Quote: All synthetic nucleic acid reagents (Dataset EV4) were ordered from Integrative DNA Technologies (IDT DNA). Cells were endogenously tagged at the N- or C-termini for MKi67 and GNL3 respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the C’-terminus (amino acids 87-164) were synthesized by IDT DNA (Coralville, IA) and cloned into lentiviral vectors containing a Tet-inducible promoter (pLenti-CMV-TRE3G-Puro ...
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Biophysics 2022Quote: DNA sequences with 5’ lipids were custom ordered from IDT DNA. DNA Sequence ‘C’ used to tether liposomes is /5DPPEK/TA GTA TTC AAC ATT TCC GTG TCGA and complementary DNA sequence ‘D’ incorporated in viral particles is /5DPPEK/TT TTT TTT TTT TTT TTT TTTTTT TTC GAC ACG GAA ATG TTG AAT ACTA with T24 linker as previously used (21) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA/RNA oligonucleotides (Supplementary File 2) were obtained from IDT DNA technologies.
-
bioRxiv - Biophysics 2023Quote: ... DNA templates were generated by PCR using a 5’-ATTO647-funtionalized (IDT DNA) 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843 ...
-
bioRxiv - Microbiology 2020Quote: All plasmids are listed in Table 2 and oligonucleotides purchased from IDT DNA or Fisher used for their construction are listed in Table 3 ...
-
bioRxiv - Immunology 2021Quote: ... 0.7 µl template switch oligo (TSO) (10 µM, f/c 200 nM, IDT DNA; #110, Supplementary table 5), nuclease-free water till 35 µl and subsequent incubation at 42°C for 2 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli C41(DE3) cells were transformed with the SARS-CoV-2 pET-28a-nsp5 plasmid (IDT DNA). Single colonies were used to inoculate LB media supplemented with kanamycin (50 μg/mL) ...
-
bioRxiv - Biophysics 2023Quote: ... all the DNA oligonucleotides were ordered with 5’-modification of Alexa Flour 488 fluorophore (from IDT DNA, Supplementary Table I).
-
bioRxiv - Developmental Biology 2023Quote: ... ordered at the 2 nmol or 10 nmol scales as Custom DsiRNAs with standard purification (IDT DNA Technologies), resuspended at 70-100 μM in 1X Bombyx injection buffer (pH 7.2 ...
-
bioRxiv - Biophysics 2023Quote: ... 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843) and a 5’-biotinylated (IDT DNA) 3’ primer with linker DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... crRNA and trRNA (1:1) were complexed using touchdown polymerase chain reaction (PCR) (IDT DNA Technologies), and Cas9 3NLS protein (IDT DNA Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantities of envelope (E) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies). Relative quantities of E gene were normalised to GAPDH mRNA levels (Applied Bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantity of nucleocapsid (N) RNA was measured using a SARS-CoV-2 (2019-nCoV) CDC qPCR N1 and control RNAseP probe set (IDT DNA Technologies). qPCR reactions were performed in duplicates with Taqman Universal PCR mix (Thermo ...
-
bioRxiv - Immunology 2020Quote: ... The relative quantities of nucleocapsid (N) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies).
-
bioRxiv - Microbiology 2022Quote: ... The relative quantities of envelope (E) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies). Relative quantities of E gene were normalized to GAPDH mRNA levels (Applied Bioscience ...
-
bioRxiv - Cell Biology 2024Quote: ... as previously described.10 Genetic correction of the pathological gene variant in the patient-derived iPSC line UMGi137-A clone 2 was performed using ribonucleoprotein-based CRISPR/Cas9 using crRNA/tracrRNA and Hifi SpCas9 (IDT DNA technologies) by targeting exon 15 of the LZTR1 gene ...
-
bioRxiv - Molecular Biology 2022Quote: Electrophoretic mobility shift assays were performed with different competitor DNA (ssDNA-salmon sperm DNA) conditions than SELEX-seq using Fam-labled dsDNA probes were generated by annealing upper fam labeled oligos (IDT DNA, Supplementary table 1). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Primary probes for iterative smFISH were obtained as a pool that contained equimolar amounts of each of the 358 oligonucelotides from IDT DNA (Supplementary Table 1). Readout probes were obtained with 3’ amino moieties and coupled to either Texas Red or Cy5 and purifed by HPLC like smFISH probes ...