Labshake search
Citations for IDT DNA :
1 - 23 of 23 citations for 5 TERT BUTOXYCARBONYLAMINO 2 CHLORO NICOTINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The hybridization solution is as follows: 0.6ng/ml Cy5 labeled 2’-O-Me-(CCCCGG)5 RNA probe (IDT DNA Technologies, IA), 0.02% BSA ...
-
bioRxiv - Immunology 2020Quote: ... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... (pan)Ifna (Forward: 5’-CTTCCACAGGATCACTGTGTACCT-3’; Reverse: 5’-TTCTGCTC TGACCACCTCCC-3’; Probe: 5’-AGAGAGAAGAAACACAGCCC CTGTGCC-3’; IDT DNA)(Samuel & Diamond ...
-
bioRxiv - Immunology 2020Quote: ... 160 ng DNA was quantified for MCMV IE1 (Forward: 5’-CCCTCTCCTAACTCTCCCTTT-3’; Reverse: 5’-TGGTGCTCTTTTCCCGTG −3’; Probe: 5’-TCTCTTGCCCCGTCCTGAAAACC-3’; IDT DNA) and host Actb (Forward ...
-
bioRxiv - Cell Biology 2020Quote: All synthetic nucleic acid reagents (Dataset EV4) were ordered from Integrative DNA Technologies (IDT DNA). Cells were endogenously tagged at the N- or C-termini for MKi67 and GNL3 respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the C’-terminus (amino acids 87-164) were synthesized by IDT DNA (Coralville, IA) and cloned into lentiviral vectors containing a Tet-inducible promoter (pLenti-CMV-TRE3G-Puro ...
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Biophysics 2022Quote: DNA sequences with 5’ lipids were custom ordered from IDT DNA. DNA Sequence ‘C’ used to tether liposomes is /5DPPEK/TA GTA TTC AAC ATT TCC GTG TCGA and complementary DNA sequence ‘D’ incorporated in viral particles is /5DPPEK/TT TTT TTT TTT TTT TTT TTTTTT TTC GAC ACG GAA ATG TTG AAT ACTA with T24 linker as previously used (21) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA/RNA oligonucleotides (Supplementary File 2) were obtained from IDT DNA technologies.
-
bioRxiv - Biophysics 2023Quote: ... DNA templates were generated by PCR using a 5’-ATTO647-funtionalized (IDT DNA) 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843 ...
-
bioRxiv - Microbiology 2020Quote: All plasmids are listed in Table 2 and oligonucleotides purchased from IDT DNA or Fisher used for their construction are listed in Table 3 ...
-
bioRxiv - Immunology 2021Quote: ... 0.7 µl template switch oligo (TSO) (10 µM, f/c 200 nM, IDT DNA; #110, Supplementary table 5), nuclease-free water till 35 µl and subsequent incubation at 42°C for 2 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli C41(DE3) cells were transformed with the SARS-CoV-2 pET-28a-nsp5 plasmid (IDT DNA). Single colonies were used to inoculate LB media supplemented with kanamycin (50 μg/mL) ...
-
bioRxiv - Biophysics 2023Quote: ... all the DNA oligonucleotides were ordered with 5’-modification of Alexa Flour 488 fluorophore (from IDT DNA, Supplementary Table I).
-
bioRxiv - Developmental Biology 2023Quote: ... ordered at the 2 nmol or 10 nmol scales as Custom DsiRNAs with standard purification (IDT DNA Technologies), resuspended at 70-100 μM in 1X Bombyx injection buffer (pH 7.2 ...
-
bioRxiv - Biophysics 2023Quote: ... 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843) and a 5’-biotinylated (IDT DNA) 3’ primer with linker DNA ...
-
bioRxiv - Biochemistry 2021Quote: RNA-ARE probes were designed from the Fgf21-3’UTR ARE sequence and synthesized with 5’-biotin end-labelling (IDT DNA technologies). HEK293 cells were transfected with the ZFP36L1 expression plasmid (pcDNA 3.1+/C-(K)-DYK Zfp36l1 ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting plasmid pLN-PP1-HA3-loxP was further modified to target endogenous pfpp1 with HA3 and loxP by introduction of a 5’ homology region for the gene (HR1, 682 bp of genomic DNA sequence for exons 2 and 3) fused to a recodonized synthetic fragment (IDT DNA) for exons 4 and 5 ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantities of envelope (E) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies). Relative quantities of E gene were normalised to GAPDH mRNA levels (Applied Bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... The relative quantity of nucleocapsid (N) RNA was measured using a SARS-CoV-2 (2019-nCoV) CDC qPCR N1 and control RNAseP probe set (IDT DNA Technologies). qPCR reactions were performed in duplicates with Taqman Universal PCR mix (Thermo ...
-
bioRxiv - Immunology 2020Quote: ... The relative quantities of nucleocapsid (N) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies).
-
bioRxiv - Microbiology 2022Quote: ... The relative quantities of envelope (E) gene were measured using SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT DNA technologies). Relative quantities of E gene were normalized to GAPDH mRNA levels (Applied Bioscience ...
-
bioRxiv - Cell Biology 2024Quote: ... as previously described.10 Genetic correction of the pathological gene variant in the patient-derived iPSC line UMGi137-A clone 2 was performed using ribonucleoprotein-based CRISPR/Cas9 using crRNA/tracrRNA and Hifi SpCas9 (IDT DNA technologies) by targeting exon 15 of the LZTR1 gene ...