Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Community-based Reconstruction and Simulation of a Full-scale Model of Region CA1 of Rat HippocampusbioRxiv - Neuroscience 2024Quote: ... and then in DAB (3, 3’ diaminobenzidine, Sigma) to reveal the morphology of the recorded neurons ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and N-hydroxysulfosuccinimide (Sulfo-NHS ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 (Sigma) in de-ionised (DI ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... 3 (Sigma) as counterstain.
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cancer Biology 2023Quote: ... asynchronously growing subconfluent KB2P1.21 or KB2P3.4 cells were labeled with 30μM thymidine analogue 5-chloro-2’-deoxyuridine (CIdU) (#C6891, Sigma-Aldrich) for 20’ ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 µM 9-Amino-6-Chloro-2-Methoxyacridine (ACMA, Sigma-Aldrich) to establish a K+ gradient ...
-
bioRxiv - Biochemistry 2023Quote: ... glucose (G8270) and β-chloro-Lalanine (C9033) were purchased from Sigma-Aldrich. Potassium phosphate monobasic (42420 ...
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) is added in ACSF to enhance the Ca2+ signals ...
-
bioRxiv - Microbiology 2024Quote: Sulfamethoxazole (IUPAC: 4-Amino-N-(5-methylisoxazol-3-yl)-benzenesulfonamide) was purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Chemical compounds were first identified using the NIST library and later confirmed with co-elution of synthetic 4-methyl-3-heptanone (Pfaltz and Bauer M19160) and 4-methyl-3-heptanol (Sigma Aldrich M48309). Compounds eluting after 30 minutes were excluded from the analysis due to lack of volatility.
-
bioRxiv - Neuroscience 2022Quote: ... 3 3’-diaminobenzidine tetrahydrochloride hydrate (DAB) (Sigma SIG-32750) in sodium acetate ...
-
bioRxiv - Bioengineering 2021Quote: ... 3- [(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Sigma RES1300C), digitonin (Sigma D141) ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by 3-3’ diaminobenzidine tetrahydrochloride (DAB, Sigma Aldrich) staining ...
-
bioRxiv - Microbiology 2022Quote: ... 3-amino-9-ethylcarbazol (3-AEC; Sigma Aldrich, Germany) was used as a chromogen ...
-
bioRxiv - Microbiology 2021Quote: ... 3-Amino-1,2,4-triazole (3-AT, A8056, Sigma Aldrich). Bovine liver catalase (C1345 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µM CHIR99021/GSK-3 Inhibitor (Millipore Sigma 361571), and 1 µM PD0325901/MEK1/2 Inhibitor (Millipore Sigma 444968 ...
-
bioRxiv - Microbiology 2021Quote: ... 3-(3-hydroxy-phenyl)propionate (Sigma Cat Number PH011597) and 3-hydroxycinnamic acid (CAS Number 14755-02-3) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.05% 3-3′ diaminobenzidine tetrahydrochloride hydrate (DAB, Sigma D5637) and 4% sucrose in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Interleukin-3 (IL-3, Cat# SRP4135-10UG, Sigma, USA), Alexa Fluor 488 EGF complex (Cat# E13345 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 0.5 nM neurotrophin-3 (NT-3, Sigma #SRP6007). Cells were released by trituration through fire-polished glass pipettes of decreasing diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mg/ml 3′,3′-diaminobenzidine tetrahydrochloride hydrate (Sigma), 24 units/ml catalase from bovine liver (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... and activating transcription factor 3 (ATF-3, HPA001562, Millipore). After three washes with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM 3-methoxybenzylamine (3-MBZ, Sigma-Aldrich #159891), and 0.5 mM benzylamine (BZA ...
-
bioRxiv - Bioengineering 2021Quote: ... and (3) 4- methylmorpholine (4.5 equiv:ELP amine; Sigma, M56557). The reagents are dissolved at room temperature (RT ...
-
bioRxiv - Neuroscience 2021Quote: ... 1-octen-3-ol (Sigma CAS #3391-86-4), 2,3-butanedione (Sigma CAS #431-03-8) ...
-
bioRxiv - Developmental Biology 2022Quote: ... CHIR99021 [3 µM] and 4.5x10-4 M Monothioglycerol (Sigma). On day 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and from days 3-5 with 5 μM IWR-1 (Sigma). From days 13-19 metabolic selection medium was used ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Complementary guide oligonucleotides (forward: 5’-CACCGCAGGATTGAAGACCTTAACA-3’; reverse: 5’-AAACTGTTAAGCTCTTCAATCCTGC-3’) were custom synthesized separately by Sigma-Aldrich (St. Louis, MO, USA), annealed ...
-
bioRxiv - Biophysics 2021Quote: ... The primers used for the same were a) A350P forward 5’-gctgcatccggccgcatctcggc-3’ and b) A350P reverse 5’-gccgagatgcggccaaggatgcagc-3’ (Sigma Aldrich, India). Full length A350P was thereafter cloned into an empty pEGFP (Clontech ...
-
bioRxiv - Developmental Biology 2024Quote: The SHMT2 gene was cloned from cDNA of HeLa cells using primers 5’-GCCCATATGGCCATTCGGGCTCAGCAC-3’ (forward) and 5’-GCCCTCGAGATGCTCATCAAAACCAGGCA-3’ (reverse) and subcloned into the pET41a vector (Novagen, WI, USA) at restriction enzyme sites of NdeI and XhoI ...