Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for Erythromycin 90 95% Erythromycin A N N Dimethyl 13C2 ~90% 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ug/mL dexamethasone (Sigma, D4902), and 0.5% gentamicin (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 ug/ml insulin (Sigma-Aldricht) and 1x penicillin/streptomycin (TFS) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ug/mL insulin (Sigma #11882), and 10 µM hydrocortisone (filtered with 0.22 µm filter) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 33.3 ug/mL aprotinin (# A6279 Sigma), 0.3 U thrombin (#T6884 Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ug/mL NAC (Sigma # A8199), 5 ug/mL insulin (Sigma #11882) ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were prepared from the cells were incubated in DNA staining solution (PBS; 1% Bovine Serum Albumin; 50 ug/ml Propidium iodide P4170-25mg Sigma-Aldrich; 100 ug/ml RNAse A 12091039 Invitrogen) on ice for at least one hour before sorting ...
-
bioRxiv - Genetics 2021Quote: ... 100 ug/mL blasticidin S (to kill cells not expressing the blasticidin-resistant plasmid; Sigma), and 10 nM AP1903 (to kill un-integrated cells expressing the AP1903-sensitive caspase gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein was eluted with a cocktail of 100 ug/ml RNase A (Sigma-Aldrich) and 0.1 units/ µL RNase H (Epicenter) ...
-
bioRxiv - Systems Biology 2019Quote: ... and methyl tert-butyl ether (MTBE) from Sigma Aldrich (Germany) in analytical grade or higher purity ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mg/mL of N-hydroxysuccinimide (NHS) ester dye (Atto 488 NHS Ester, Sigma Aldrich) was mixed with 50 mM borate buffer (pH 9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.5 µg/ml of N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)-treated trypsin (Sigma). At 72 h p.t. ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 μg/ml N-tosyl-l-phenylalanine chloromethyl ketone (TPCK) treated trypsin (Sigma Aldrich) for MDCK cells ...
-
bioRxiv - Immunology 2020Quote: ... with 1 µg/ml of N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)-treated trypsin (Sigma), and incubated at 37°C ...
-
bioRxiv - Physiology 2024Quote: ... supplemented with 50 ng/ml mouse Nerve Growth Factor-7S (NGF, N 0513, Sigma-Aldrich), 10% horse serum and 50 µg/ml gentamicin ...
-
bioRxiv - Bioengineering 2023Quote: ... Tendons (n = 5/group/time) were then digested with proteinase-K (5 mg/ml) (Sigma) for 18 hours and stored at -20C until further assays could be performed ...
-
bioRxiv - Neuroscience 2022Quote: ... Diphtheria toxin (DT, Sigma D0564, 100 ug/kg) was then administered i.p ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were infected by spinoculation at 2500 rpm for 90 minutes at 37°C with 125 µL zip coded viral media and 0.4 mg/ml polybrene (Sigma Aldrich, St. Louis, MO) in 2.5 ml of supplemented RPMI ...
-
bioRxiv - Genomics 2022Quote: ... Jurkat cells were spinoculated in 50 ml conical tube with the lentivirus library at 800×g for 90 minutes at 32°C with 0.8 μg/ml polybrene (EMD Millipore #TR-1003-G) and 10 μM HEPES (Life Technologies #15630080) ...
-
bioRxiv - Plant Biology 2019Quote: ... Twenty-five disinfected seeds were laid onto flat Whatman filter paper in 90 mm Petri dishes with 20 mL of osmotic solutions of high molecular weight PEG (Polyethylene glycol 8000, ref. SIGMA 25322-68-3). The latter was used at different concentrations to control water potential as described previously (Michel ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEL cells were infected with viral supernatants via spinoculation (1000 g for 90 min at 30°C) with addition of 4 μg/mL polybrene (Sigma-Aldrich, Cat #H9268). 48 hours after transduction ...
-
bioRxiv - Cancer Biology 2022Quote: ... 8 ml of the suspension was filtered using a cell strainer (70 µm mesh) and then mixed with 4 ml of 90 % Percoll solution (Sigma-Aldrich, MO, USA). The suspension was then centrifuged at 700 × g for 20 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Single cell suspensions from tissues were created by treating them for 60-90 min (60 min for DRG and 90 min for skin) at 37°C with 250 μg/ml Liberase (Millipore-Sigma; St. Louis, MO) and 100 μg/ml dispase I (Millipore-Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... N-acetyl-DL-leucine was obtained from Molekula (#73891210) and N-acetyl-L-leucine was obtained from Sigma Aldrich (#441511).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... SAG1.3 (3-Chloro-N-[trans-4-(methylamino)cyclohexyl]-N-[[3-(4-pyridinyl)phenyl]methyl]benzo[b]thiophene-2-carboxamide) was from Sigma. Cyclopamine-KAAD and SANT-1 ((4-Benzyl-piperazin-1-yl)-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-ylmethylene)-amine ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were dissolved in 50 μL of 20 mg/ml methoxyamine hydrochloride in pyridine for 1.5 h at 33°C followed by derivatization with N-Methyl-N-(trymethylsolyl)trifluoroacetamide (MSTFA, Sigma Aldrich) for 2 h at 35°C.
-
bioRxiv - Microbiology 2021Quote: ... 4 mg of Arixtra was added to 10 volumes (w/w) of N-Methy-N-(trimethylsilyl)-trifluoroacetamide (MTSTFA, Sigma, ≥98.5%) and 100 volumes (v/w ...
-
bioRxiv - Plant Biology 2020Quote: ... The combined organic phase was dried using CentriVap Cold Traps (Labconco) and derivatized using bis-(N,N,-trimethylsilyl)-tri-fluoroacetamide (BSTFA; Sigma) as described previously (Franke et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Terminal cellular differentiation was induced with 10 μM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT; Sigma-Aldrich) while mucus-secretion was enhanced with 10 nM phorbol 12-myristate 13-acetate (PMA ...
-
bioRxiv - Cell Biology 2021Quote: SK-N-SH-N cells were plated onto 6-well tissue culture plates coated with poly-L-lysine (Sigma-Aldrich). Cells were plated at 3×105 cells/ml in MEMα medium containing a very low-serum level (2% FBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 1h at 37°C and then with 20μL 1% tert-butyldimethylchlorosilane in N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma Aldrich) for 3h at 60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... in pyridine at 70°C for 15 min followed by addition of N-tert-Butyldimethylsiyl-N-methyltrifluoroacetamide (MTBSTFA, Sigma-Aldrich) for 1 hour ...
-
bioRxiv - Plant Biology 2021Quote: ... The sample was then derivatized by adding 60 μL N-methyl-N-(trimethylsilyl)trifluoro acetamide (MSTFA) (Cat# 69479; Sigma-Aldrich) and incubating for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The gelatin was subsequently cross-linked using N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC hydrochloride) (Sigma Aldrich Catalog No-03450) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Molecular Biology 2019Quote: ... Small RNAs were crosslinked to the membrane by chemical crosslink using N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC, Sigma-Aldrich). Membrane was pre-hybridized for 20 min with PerfectHyb(tm ...
-
bioRxiv - Biophysics 2019Quote: ... 2 M NaCl, 8.625% [w/w, Sigma] sodium acrylate, 2.5% [w/w, Sigma] acrylamide, 0.15% [w/w, Sigma] N,N′-methylenebisacrylamide) was mixed and cooled to 4 °C before use ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were treated for 16 hours with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-phenylglycin T-butyl ester (DAPT) (Sigma Aldrich), an inhibitor of γ-secretase ...
-
bioRxiv - Neuroscience 2021Quote: ... received bilateral infusions of either vehicle (aCSF; pH 7.4; males n = 5; females n = 4) or the GABAA receptor agonist muscimol (Sigma Aldrich, M1523 ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with the noradrenergic neuron specific neurotoxin N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP4; Sigma, C8417) once at a dose of 50 mg/kg (i.p.) ...
-
bioRxiv - Microbiology 2022Quote: ... The dried remainder of eluate 2 was dissolved in 50 µl dry acetonitrile and 50 µl N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide containing 1% tert-butyldimethylsilyl chloride (Sigma) and kept at 70°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... animals were injected with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (Sigma, Cat no. D5942) (10 mg/kg/day ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The ML321 was dissolved in a small amount of N,N-dimethylacetamide (DMA) with previously heated Tween-80 (Sigma-Aldrich) and vortexed until the solution was solubilized ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were then further incubated with 20 µL of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 60 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult female SNSiDTR (n=6) and TrkBiDTR (n=19) mice were injected i.p with 40 μg/kg DTX (Sigma, D0564) with a second dose after 72 h ...
-
bioRxiv - Immunology 2023Quote: ... were added followed by dropwise addition of 500 µl 2X BES (50 mM N,N-bis(2hydroxyethyl)-2-aminoethanesulfonic acid (Sigma) + 280 mM NaCl (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dried samples were first resuspended in a 1:1 v/v mixture of a 1% solution of N,N-diisopropylethylamine (Sigma) and a 1% solution of pentaflurobenzylbromine (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Bioengineering 2022Quote: ... Triton X-100 and N-hydroxysulfosuccinimide (sulfo-NHS) were all acquired from Sigma-Aldrich (St. Louis, MO). Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
bioRxiv - Bioengineering 2020Quote: A chemoattractant solution was made by preparing 100 nM N-Formyl-Met-Leu-Phe (fMLP, Millipore Sigma) in 0.4% BSA/RPMI ...