Labshake search
Citations for Millipore Sigma :
801 - 850 of 10000+ citations for 3 2 Isopropylphenyl 1 propene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 3-isobutyl-1-methylxanthine (0.5 mM; Sigma, 28822-58-4), indomethacin (200 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1% serine/threonine phosphatase inhibitor cocktail #3 (Sigma, P0044). Detergent soluble lysates were sonicated for 10 pulses at 35% power and centrifuged at 15,000 rpm for 15 minutes at 4°C to remove cell debris ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 3-isobutyl-1-methylxanthine (IBMX) were purchased from Sigma–Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... or 10 mM 3-Azido-1-propanamine (Sigma–Aldrich, 762016), in 50 mM Tris pH 7.5 ...
-
bioRxiv - Immunology 2020Quote: ... Enzymatic digestion with 3 mg/ml collagenase type 1 (Sigma) and 1.5 mg/ml trypsin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: Rat insulinoma cell line INS-1 832/3 (Millipore Sigma) was cultured in RPMI-1640 supplemented with 2mM L-Glutamine ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-cleaved Caspse 3 (1:500, Millipore Sigma AB3623), and goat anti-PDGFRα (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-octanol (1:1000 in mineral oil; Sigma-Aldrich, 218405) or 4- methylcyclohexanol (1:1000 in mineral oil ...
-
bioRxiv - Genetics 2023Quote: ... 1,115 μg/ml 3-Isobutyl-1-methylxanthine (Sigma-Aldrich #I5879) and 2 μM rosiglitazone (Sigma-Aldrich #R2408) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX; Sigma, No.I5879) (DCI) ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Molecular Biology 2022Quote: ... treated twice using 1-Bromo-3-chloropropane (Sigma-Aldrich, B9673) followed by RNA precipitation using 2-propanol (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2024Quote: ... 1% phosphatase inhibitor cocktail 3 (Sigma-Aldrich, St. Louis, MO), 10 mM N-ethylmaleimide (NEM) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 μM 3-isobutyl-1-methylxanthine (IBMX, Millipore Sigma) were added 30 min later for 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 μL of 1-bromo-3-chloro-propane (Sigma-Aldrich) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-GAPDH (Millipore, MAB374, 1:300,000 in 3% BSA).
-
bioRxiv - Biophysics 2023Quote: ... 50 mM 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS, Millipore Sigma), 0.3% N-lauroyl sarcosine (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFAP-Cy3 (Sigma-Aldrich, #C9205, 1:800, 3 days), and anti-VGLUT1/2 (Synaptic Systems ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit polyclonal antibody to GluR2/3 (1:100; #AB1506; Millipore) or a rabbit polyclonal antibody to NPY (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Rabbit anti-caspase 3 active cleaved (1:1000, AB3623, Millipore).
-
bioRxiv - Bioengineering 2022Quote: ... 1 μl of (3-mercaptopropyl)trimethoxysilane (MPTMS) (Sigma Aldrich, 175617) and 1 ml of AuNRAg (extinction ∼2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pan-RAS antibody (Ab-3, 1:1000) was from Millipore. Antibodies against KRAS (12063-1-AP ...
-
bioRxiv - Genomics 2022Quote: ... 40 μl of 1-bromo-3-chloropropane (BCP) (Sigma, B9673) was added to the samples and samples were vortexed for 20 sec ...
-
bioRxiv - Microbiology 2022Quote: ... 0.1mM 3-Isobutyl-1-methylxanthine (IBMX) (Sigma-Aldrich, Cat. I5879) and PenStrep ...
-
bioRxiv - Genomics 2022Quote: ... 1-bromo-3-chlorophenol (100 μL; Sigma-Aldrich, Taufkirchen, Germany) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX; Sigma-Aldrich) (“CI”) ...
-
bioRxiv - Cancer Biology 2022Quote: ... colonies were fixed with 3% PFA + 1% glutaraldehyde (Sigma-Aldrich) for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mM 3-mBz (m-toluic acid, Sigma-Aldrich) to induce msfGFP production ...
-
bioRxiv - Biochemistry 2024Quote: ... using 3:1 polyethylenimine (average Mw, ∼25,000 Da; Sigma-Aldrich) to total DNA ratio (4 μg BRSK and 2 μg TAU DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.5 mM 3-isobutyl-1-methylxanthine (IBMX, Sigma, #I5879). After two days ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phase separation was achieved with 1-bromo-3-chloropropane (Sigma), and the resulting aqueous phase was precipitated in isopropanol ...
-
bioRxiv - Bioengineering 2024Quote: ... and phase-separated in 1-bromo-3-chloropropane (B9673, Sigma) [82,95] ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM DTT supplemented with 3 mM ATP (Sigma) and 3 mM MgCl2 ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Biophysics 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Biochemistry 2022Quote: ... also contained 1-2 µg/uL α-MBPAF546 or 1-2 µg/uL mouse α-BRCA2 (Ab1, Millipore) plus 1-2 µg/µL goat α-mouse IgGAF546 (Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.