Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... N6,2-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (D0627, Sigma-Aldrich), and ascorbic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were cultured in hypoxia and treated with 50µM 3-bromopyruvate (3-BP) (Sigma, 376817) dissolved in DMSO.
-
bioRxiv - Immunology 2021Quote: ... (3) TexMACS™ medium (Miltenyi) was supplemented with 3% heat-inactivated human AB serum (Sigma) and 1X Penicillin Streptomycin solution (TAC) ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Molecular Biology 2022Quote: ... home-made LIF conditioned medium and 2i inhibitors: 3 μM GSK-3 inhibitor XVI (Sigma) and 10 μM MEK inhibitor PD0325901 (Tocris)) ...
-
bioRxiv - Developmental Biology 2022Quote: Caspase 3 activity was measured using the Caspase-3 Colorimetric Activity Assay Kit (APT131, Millipore). Briefly ...
-
bioRxiv - Biophysics 2023Quote: ... we prepared a mixture containing 100mM 1-Ethyl-3-(3’-dimethylaminopropyl)carbodiimide HCL (8510070025, Sigma), and 200mM N-Hydroxysuccinimide (130672 ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were placed into 1/3 Methanol and 2/3 dichloromethane (DCM, Sigma-Aldrich, 270997) with rotation at 13rpm at room temperature for overnight incubation ...
-
bioRxiv - Microbiology 2024Quote: ... Isoprenol (3-methyl-3-buten-1-ol, 97% purity, 129402) was purchased from Sigma-Aldrich and added directly to the filtered M9 medium to specified concentrations as described in the text.
-
bioRxiv - Genomics 2024Quote: ... we performed gel passivation using 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC; Sigma-Aldrich #E7750) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2020Quote: ... larvae and adults were incubated in 3 μM and 2.5 μM 4-hydroxytamoxifen (4-OHT, Sigma), respectively ...
-
bioRxiv - Developmental Biology 2020Quote: ... or 1000 nM of 2-(4-amino-1-isopropyl-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-1H-indol-5-ol (PP242; Sigma, P0037), (2 ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with antibodies (5-8 μg) overnight at 4°C followed by incubation for 3 hours with protein G-sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... after 72 hours of drug treatment, 20μl of a 5mg/mL 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (M2128-MTT; Sigma-Aldrich, USA) solution was added to each of the wells ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: Cytotoxicity of Quercetin and other natural compounds was evaluated using MTT (3-(4, 5- dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye) assay (Sigma Aldrich). Following the drug treatment in triplicate at indicated concentrations ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Systems Biology 2024Quote: ... Cells were cultivated under humidified conditions with 5% CO2 at 37°C and passaged every 3-4 days using 0.05% trypsin/EDTA (Sigma-Aldrich). Cells were harvested in ice-cold PBS buffer using a cell scraper ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (PI(4,5)P2) in chloroform: methanol (Millipore MX0488): water (20:9:1 ...
-
bioRxiv - Biophysics 2020Quote: ... passaged every 3-4 days by trypsinization with trypsin-EDTA solution (Sigma-Aldrich) and moved to the corresponding Petri dishes ...
-
bioRxiv - Plant Biology 2021Quote: Starting reagents 3-hydroxybenzaldehyde 4 and hydrazine hydrate were purchased from Sigma-Aldrich and phenylacetic acid 1 was purchased from Merck ...
-
bioRxiv - Cancer Biology 2021Quote: ... noggin and EGF and containing 10 µM nutlin-3 (Sigma #675576-98-4).
-
bioRxiv - Neuroscience 2020Quote: ... The odorants used were 0.1% 3-octanol and 0.1% 4-methylcyclohexanol (Sigma Aldrich), controlled via three-way solenoids (Lee Company) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked overnight at 4°C in DPBS with 3% BSA (Sigma, A9647) and 0.05% TritonX-100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3×10-4 M monothioglycerol and 300 μg/ml human transferrin (Sigma Aldrich). Cells were plated in petri dishes (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... and used without further purification: 4-Hydroxy-3-methoxycinnamaldehyde (458-36-6, Sigma), 3-ethoxy-4-hydroxybenzaldehyde (121-32-4 ...
-
bioRxiv - Bioengineering 2023Quote: ... For ECM conjugation using L-DOPA (3, 4- Dihydroxy-L-phenylalanine, D9628, SIGMA),[23] 2 mg ml-1 L-DOPA solution was prepared using 10 mM Tris-HCL buffer (pH balanced to 10.2 using 1 M NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... coverslips were transferred to a 4% solution of (3-aminopropyl) triethoxysilane (Sigma #440140) in acetone for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C with 3 K Amicon® Ultra-15 centrifugal filters (Merck Millipore). All fractions were stored as aliquots at − 80 °C for later use ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by perfusion with 4% paraformaldehyde (PFA) for 3 minutes (Sigma-Aldrich, USA) dissolved in 0.1 M Phosphate Saline Buffer (PBS ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... we injected 4-Hydroxytamoxifen (H6278, Sigma-Aldrich, 1 mg/kg i.p., 3 times) into pups at P7 to P9 ...
-
bioRxiv - Neuroscience 2021Quote: ... FW 5’ – CCA CAT GGG AGA GTC ACA T −3’ and RV 5’-ATA GCC TGG AAG CGG TCA GAT G −3’ (Sigma-Aldrich Japan, Inc., Tokyo, Japan). The PCR products (521 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were dehydrated in increasing concentrations of ethanol for 5 min each (2 × 35%, 50%, 70%, 80%, 90%, 3 × 100%) and washed 3 x 5 min with propylene oxide (Sigma- Aldrich, #cat 110205-18L-C). Sections were next embedded overnight at RT in Durcupan resin (20g component A ...
-
bioRxiv - Cell Biology 2024Quote: ... Dichlormethane (DCM, ≥99 %), 4,5-Dimethoxy-2-nitrobenzyl chloro formate (NVOC-Cl, 97%) were purchased from Sigma Aldrich. Fmoc-Hyp(tBu)-OH (99 % ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...