Labshake search
Citations for GENEWIZ :
1 - 24 of 24 citations for Mouse WD repeat containing protein WRAP73 WRAP73 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Different versions of codon optimized PUF repeats from human PUM1 that recognize all four RNA bases were chemically synthesized (GENEWIZ). The eight or ten PUF repeats were assembled by PCR amplification and inserted to N-terminal of ADARs to generate various AI-REWIRE expression vectors ...
-
bioRxiv - Immunology 2019Quote: ... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
bioRxiv - Genetics 2022Quote: ... the 702 bp mouse PID region was synthesized by GENEWIZ and excised from the pUC57 vector with NotI and XhoI sites for integration between the AF and E regions ...
-
bioRxiv - Molecular Biology 2020Quote: A gRNA library containing 4975 gRNA targeting 829 RBP (Table EV1) was synthesized by GENEWIZ and cloned into CROP-seq vector (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: 2645 polypeptides derived from above proteins were synthesized (GENEWIZ, Shanghai, China) to fabricate Microarray 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... this protein-coding region was synthesized by GENEWIZ (Plainfield, NJ, USA) based on the published genomic sequence of M ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PRE-mutant (PREmut) construct containing 18 PRE mutations (TGT to ACA) was synthesized by GENEWIZ. The 5’ deletion construct (Δ1-898) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a gRNA that targeted the PlexA gene just after the transmembrane domain (CTTCGCTCACAGGCGATCTTACTTC) was injected into nos-Cas9 expressing flies together with a pUC57 plasmid containing a donor construct (synthesized by GENEWIZ/Azenta) flanked by gRNA1 target sites that would insert an HA tag and 3X STOP cassette ...
-
bioRxiv - Neuroscience 2021Quote: ... and a portion of intron 15 (corresponding to mouse genomic DNA chr16:84,965,084-84,965,993 GRCm38/mm10) was synthesized by GENEWIZ and was housed within a vector that contained the neo cassette on the vector backbone ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... The coding sequence for SARS-CoV-2 RBD spanning S protein 319-541 (GenBank: YP_009724390) was codon-optimized for mammalian cells and synthesized by GENEWIZ, China ...
-
bioRxiv - Microbiology 2021Quote: ... RBD fragment (aa319-541) of SARS-CoV-2 S protein (GenBank: MN908947.3) was synthesized by Genewiz Inc (GENEWIZ, Suzhou, China), the extracellular domain of human ACE2 (1-740 aa ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions and deletions in the SARS-CoV-2 spike protein (shown in Figure 2) were introduced using standard molecular biology techniques135 and confirmed by Sanger sequencing (GENEWIZ). When indicated ...
-
bioRxiv - Systems Biology 2022Quote: ... Sequencing library was prepared using a MetaVx™ 16s rDNA Library Preparation kit and ITS-2 Library Preparation kit (GENEWIZ, Inc., South Plainfield, NJ, USA). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome capture was performed by GENEWIZ with the Agilent SureSelect Mouse Exon system and sequenced on the Illumina platform generating 150bp PE reads (GENEWIZ Ltd, Hong Kong). Reads were mapped using BWA mem (v0.7.15-r1140 ...
-
bioRxiv - Microbiology 2022Quote: ... The beta variant of the SARS-CoV-2 spike protein (L18F, D80A, D215G, del242/243, R246I, K417N, E484K, N501Y, A701V) was synthesized in two fragments (GENEWIZ, South Plainfield, NJ, USA) and cloned into the pcDNA3.1+ expression vector (Cat# V79020 ...
-
bioRxiv - Biochemistry 2020Quote: ... The cDNA was isolated using QIAGEN (Hilden, Germany) mini prep kits and sequenced (GENEWIZ, South Plainfield, NJ). Constructs containing the appropriate amino acid replacements were transfected into HEK293 cells for functional or expression studies as described below.
-
bioRxiv - Microbiology 2023Quote: ... The sequencing library was prepared using a MetaVx™ Library Preparation kit (GENEWIZ, Inc., South Plainfield, NJ, USA). V3 and V4 regions were amplified using forward primers containing the sequence ’CCTACGGRRBGCASCAGKVRVGAAT’ and reverse primers containing the sequence ’GGACTACNVGGGTWTCTAATCC’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequencing libraries was prepared using the 16S MetaVx™ Mammalian Library Preparation kit (GENEWIZ, Inc., South Plainfield, NJ, USA). Briefly ...
-
bioRxiv - Genomics 2020Quote: ... The mRNA libraries were created using TruSeq RNA kit (LANGEBIO, CORE-FACILITY) and sequenced on an Illumina HiSeq 2500 platform using 2×150 paired-end format (GENEWIZ). The small RNA libraries were created using the Illumina TruSeq small RNA kit and sequenced on an Illumina HiSeq 2500 with a 1×50 single-end format (GENEWIZ).
-
bioRxiv - Genomics 2020Quote: ... The small RNA libraries were created using the Illumina TruSeq small RNA kit and sequenced on an Illumina HiSeq 2500 with a 1×50 single-end format (GENEWIZ).
-
bioRxiv - Cancer Biology 2022Quote: ... RNA library preparation using the NEBNext Ultra RNA Prep Kit for Illumina and next generation sequencing through Illumina HiSeq were conducted by GENEWIZ, LLC ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome-sequencing was performed using SureSelect all human V6 capture kit and Illumina sequencing (GATC, Konstanz, Germany and GENEWIZ, Leipzig, Germany). Total RNA was isolated from frozen PDO pellets using the RNeasy Plus Mini Kit (Qiagen ...
-
bioRxiv - Plant Biology 2024Quote: ... and 30-50 ng of DNA were used to generate amplicons using a MetaVx™ Library Preparation kit (GENEWIZ, Inc., South Plainfield, NJ, USA).