Labshake search
Citations for GENEWIZ :
1 - 50 of 50 citations for Mouse BEX1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Plasmids were verfieid by sequencing (GENEWIZ) and transformed as previously described80.
-
bioRxiv - Neuroscience 2022Quote: The two donor plasmids for inducible expression of six codon-optimized transcription factors were constructed using the plasmid pUCM (GENEWIZ). Human iPSCs (WTC11) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All plasmids were verified by Sanger sequencing (GENEWIZ).
-
bioRxiv - Microbiology 2020Quote: ... PCR products and plasmids were sequenced by GENEWIZ, inc ...
-
bioRxiv - Immunology 2023Quote: ... LLOV (JF828358) GP plasmids were synthesized by GENEWIZ and then cloned into the expression vector pcDNA3.1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid sequences were verified by Sanger sequencing (GENEWIZ Inc).
-
bioRxiv - Synthetic Biology 2022Quote: ... All plasmid constructs were confirmed by Sanger sequencing (GENEWIZ).
-
bioRxiv - Microbiology 2023Quote: ... Plasmid constructs and PCR products were sequenced by GENEWIZ (Azenta Life Sciences ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All plasmid constructs were confirmed by Sanger sequencing (GENEWIZ). Selected plasmids will be deposited on Addgene (https://www.addgene.org/Jesse_Zalatan/).
-
bioRxiv - Molecular Biology 2024Quote: ... so-called target plasmids were synthesized (GENEWIZ, Leipzig, Germany) that contained the following elements ...
-
bioRxiv - Microbiology 2020Quote: ... All plasmids made by PCR cloning were sequenced by GENEWIZ, Inc ...
-
bioRxiv - Synthetic Biology 2021Quote: ... All general plasmids were checked correctly with Sanger Sequencing (GENEWIZ) unless otherwise noted ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sanger sequencing of resulting plasmids was carried out by GENEWIZ.
-
bioRxiv - Synthetic Biology 2023Quote: ... All plasmid sequencing was performed by GENEWIZ (South Plainfield, NJ) or alternatively by Plasmidosaurus (Eugene ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Plasmids with GPR1 mutations were confirmed by DNA sequencing (GENEWIZ).
-
bioRxiv - Biochemistry 2024Quote: ... All plasmids were sequence verified by GENEWIZ (Aventa Life Sciences). Amino acid sequences for the genes are listed below (pp 42-26).
-
bioRxiv - Biophysics 2022Quote: ... The sequence of all plasmids was confirmed by sequencing by GENEWIZ.
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids were verified by Sanger sequencing (GENEWIZ, Inc./Azenta Life Sciences) and are available on Addgene (plasmid #203157 and #203158).
-
bioRxiv - Synthetic Biology 2021Quote: ... The integrity of all plasmids was verified by Sanger Sequencing (GENEWIZ Europe).
-
bioRxiv - Microbiology 2022Quote: ... The construction of plasmids pTAP-AFAP and pTAP was completed by GENEWIZ, Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... WT and mutant plasmids were confirmed by sequencing (GENEWIZ corp., Tokyo, Japan) and were checked for errors by comparing to their respective WT and mutant sequences using BioEdit software 7.0.5.3 (http://www.bioedit.com/).
-
bioRxiv - Microbiology 2019Quote: ... and verified the plasmid sequences using Sanger sequencing (GENEWIZ, South Plainfield, New Jersey). Prior to use in ddPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... KLK10 plasmid expressing secreted KLK10 and luciferase (pCMV-Igκ-KLK10-T2A-Luc) from GENEWIZ or luciferase plasmid (pCMV-Luc ...
-
bioRxiv - Molecular Biology 2020Quote: ... and plasmids were extracted using Qiagen Miniprep columns and confirmed by Sanger sequencing (GENEWIZ). Transformed cells were cultured in liquid LB media or LB agar media ...
-
bioRxiv - Biochemistry 2021Quote: ... All plasmids used in this study were sequence verified by GENEWIZ (South Plainfield, NJ) or EurofinsGenomics (Louisville ...
-
bioRxiv - Immunology 2022Quote: ... The DNA sequences of all plasmids were verified by Sanger sequencing performed by GENEWIZ. Methods for LV production have been previously described (44) ...
-
bioRxiv - Cell Biology 2023Quote: ... All plasmids and strains were validated by Sanger sequencing (GENEWIZ Brooks Life Science, UK).
-
bioRxiv - Bioengineering 2020Quote: ... All of the constructed plasmids were verified by DNA sequencing (GENEWIZ, South Plainfield, NJ, USA).
-
bioRxiv - Biochemistry 2019Quote: ... The pCMV-HFABE7.10 plasmid was constructed through Gibson assembly of necessary sequence (synthesized by GENEWIZ) into the pCMV-ABE7.10 ...
-
bioRxiv - Genetics 2023Quote: QC was performed for the plasmid pools using the Amplicon-EZ service provided by GENEWIZ (Extended Data Fig ...
-
bioRxiv - Genetics 2022Quote: ... the 702 bp mouse PID region was synthesized by GENEWIZ and excised from the pUC57 vector with NotI and XhoI sites for integration between the AF and E regions ...
-
bioRxiv - Molecular Biology 2021Quote: ... see plasmid maps and catalogue of donors in excel file S1) were commercially synthesised by GENEWIZ (FragmentGENE), ThermoFisher (geneArt Gene Synthesis ...
-
bioRxiv - Microbiology 2021Quote: ... The introduction of the desired mutation R to T was verified by sequencing purified plasmids by GENEWIZ. The plasmid harboring the mutation was further amplified and purified with EndoFree maxi kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli and plasmid was extracted using Qiagen Miniprep columns and clones were confirmed by Sanger Sequencing (GENEWIZ). Whole plasmid sequence was confirmed by nanpore long read sequencing (Plasmidsaurus) ...
-
bioRxiv - Biochemistry 2021Quote: ... Point mutants in plasmid pPR-IBA1-CylK were synthesized and sequence verified by GENEWIZ (South Plainfield, NJ, USA), DNA sequences available (Fig ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid pUC57-S-eGFP was synthesised by sub-cloning the eGFP-P2A ORF (GenBank accession number: QFU20120.1; GENEWIZ) into pUC57-S ...
-
bioRxiv - Synthetic Biology 2023Quote: The inserts used for the construction of the desired plasmids were synthesized by GENEWIZ (Azenta Life Sciences, Germany), prepared by polymerase chain reaction (PCR ...
-
bioRxiv - Biochemistry 2019Quote: ... besides we optimized its codon according previous report [24].The sgRNA plasmid pUC57-Cas9-gRNA was synthesized by GENEWIZ. The pCMV-eABE7.10 ...
-
bioRxiv - Plant Biology 2022Quote: The IPT7::3xGFP plasmid was obtained as follow: 5.8 kb of IPT7 promoter driving nuclear 3xGFP were synthetized by GENEWIZ and inserted into PMLBART vectors via NotI flanking sites.
-
bioRxiv - Microbiology 2021Quote: ... Plasmids with the correct inserts were confirmed by Sanger sequencing using the “U6” Universal Primer from GENEWIZ (LKO.1 5’) which is located in the human U6 promoter (Table 1).
-
bioRxiv - Microbiology 2019Quote: ... Purified plasmids were stored at −20 °C before being sent to sequencing using T7p and SP6 universal primers (GENEWIZ, UK).
-
bioRxiv - Microbiology 2022Quote: ... We generated standard curves using a 10-fold serial dilution of the standards by cloning the 18S region of the fungus Saccharomyces cerevisiae or the 16S region of the bacteria Escherichia coli into puc57 plasmid vectors constructed by GENEWIZ, Inc ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The full sequences of all plasmids are listed in Supplementary Information (Excel Sheet Data) and their correctness is verified by Sanger sequencing (GENEWIZ) unless otherwise noted ...
-
bioRxiv - Genetics 2023Quote: ... candidate plasmids recovered from yeast surviving appropriate genetic selection were evaluated by both restriction digest and DNA sequence analyses (GENEWIZ / Azenta Life Sciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmid donor carrying the sequence to be inserted plus 500nt of homology upstream and downstream was synthetized by GENEWIZ. 106 SK-N-BE cells were transfected with 3μL of Lipofectamine 2000 (Life technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... pAWG-GFP-Nup98AG and pAWG-GFP-Nup98YG plasmids were generated by PCR amplification of Nup98AG and Nup98YG (obtained as geneblock from GENEWIZ) and cloning into AscI/PacI-digested pCopia-3XFLAG-StrepII-HA vector or pAWG-EGFP vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a gRNA that targeted the PlexA gene just after the transmembrane domain (CTTCGCTCACAGGCGATCTTACTTC) was injected into nos-Cas9 expressing flies together with a pUC57 plasmid containing a donor construct (synthesized by GENEWIZ/Azenta) flanked by gRNA1 target sites that would insert an HA tag and 3X STOP cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... the midP0188 encoding sequence was cloned into PiggyBac Dual promoter to generate midP0188-PiggyBac Dual promoter (GFP-Puro) Plasmid by GENEWIZ (Suzhou). According to the instructions of Neofect (Neofect Biotech Co. ...
-
bioRxiv - Neuroscience 2021Quote: ... and a portion of intron 15 (corresponding to mouse genomic DNA chr16:84,965,084-84,965,993 GRCm38/mm10) was synthesized by GENEWIZ and was housed within a vector that contained the neo cassette on the vector backbone ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome capture was performed by GENEWIZ with the Agilent SureSelect Mouse Exon system and sequenced on the Illumina platform generating 150bp PE reads (GENEWIZ Ltd, Hong Kong). Reads were mapped using BWA mem (v0.7.15-r1140 ...