Labshake search
Citations for Addgene :
1 - 43 of 43 citations for Yeast Extract since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and further into pAG423Gal-ccdB (high copy yeast expression plasmid) and pAG413Gal-ccdB (low copy yeast expression plasmid) vectors (Addgene plasmid #14149 and 14141) through standard Gateway Cloning protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The MoClo Yeast Toolkit25 was obtained from Addgene (Kit # 1000000061) and was a gift from Prof ...
-
bioRxiv - Microbiology 2020Quote: ... provided as part of the Yeast MoClo Toolkit (AddGene ID # 65143)54.
-
bioRxiv - Bioengineering 2022Quote: ... pAG423GAL-ccdB-eGFP plasmid for yeast expression was obtained from Addgene[28] ...
-
bioRxiv - Neuroscience 2022Quote: ... The Gal4 cDNA/hsp70 yeast terminator sequence was amplified from pBPGuW (Addgene). A donor plasmid was generated by combining a 1,050-bp left homology arm ...
-
bioRxiv - Genomics 2020Quote: ... Yeast-optimized yECitrine coding sequence was amplified from pNTI189 (pKT0139 AddGene #8731) (54 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast Toolkit plasmids were a gift from John Dueber (Addgene kit # 1000000061). pAJ4619 was made from pAJ4618 by inverse PCR using oligos AJO3551 and AJO3539 ...
-
bioRxiv - Biophysics 2021Quote: The plasmid containing yeast (Saccharomyces cerevisiae) Ubr1 was purchased from Addgene (plasmid # 24506) 41 ...
-
bioRxiv - Biochemistry 2022Quote: ... yeast expression vector while HsTOP2β was inserted into the 12URA-C (Addgene #48305) yeast expression vector using Ligation Independent Cloning (LIC) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the gene coding yeast tRNAPhe was cloned in the pBSTNAV vector (Addgene ID 45801), expressed in LB for unlabelled sample preparation or 15N-labelled Spectra-9 medium (Eurisotop ...
-
bioRxiv - Systems Biology 2020Quote: ... Yeast competent cells were co-transformed with a pCAS plasmid (Addgene plasmid 60847, (46)) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Genetics 2022Quote: Yeast transformed with the plasmid FLII12Pglu-700μδ6 (pSL590, [a gift from Wolf Frommer: Addgene #28002 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... A synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #:1000000061). Characterization plasmids consisted of 8 parts ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast expression constructs for nuclease-inactivated Cas9 (D10A/H840A mutations) from Streptococcus pyogenes –dCas9 (Addgene #46920) (Gilbert et al 2013 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... https://github.com/desai-lab/compensatory_epistasis_omicron/tree/main/Supplementary_Files) into pETcon yeast surface-display vector (plasmid 2649; Addgene, Watertown ...
-
bioRxiv - Bioengineering 2023Quote: A synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #1000000061). Expression vectors for yeGFP ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas929 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas9 with the PCR amplified MYO3 and MYO5 SH3 single position mutated libraries from the pUC19 preparations acting as the donor DNA29 ...
-
bioRxiv - Genetics 2020Quote: ... The yeast were then transformed with 100 ng of CRISPR-Swap plasmid (pFA0055-gCASS5a, Addgene plasmid # 131774) and 1 μg of DNA repair template amplified either from BY ...
-
bioRxiv - Immunology 2021Quote: ... Yeast scFv display libraries were generated using the amplified VH and VL DNA libraries from above and the pYD1 yeast surface display vector (Addgene plasmid #73447; https://www.addgene.org/73447/; RRID:Addgene_73447) (60) ...
-
bioRxiv - Immunology 2020Quote: ... The yeast vector was generated by modification of the commercially available pCTcon2 vector (Addgene; Chao et al., 2006). The mutant N-CSP insert was cloned with N-terminal V5 and C-terminal HA epitope tags ...
-
bioRxiv - Microbiology 2022Quote: ... residues 336-528] yeast surface expression was established using Saccharomyces cerevisiae EBY100 strain and pJYDC1 plasmid (Addgene, Cat# 162458) as previously described22 ...
-
bioRxiv - Molecular Biology 2019Quote: The ATP sensor AT1.03 and its inactive variant AT1.03R122KR126K in the yeast expression vector pDRF1-GW were a gift from Wolf Frommer (Addgene plasmids #28003 and #28005 ...
-
bioRxiv - Systems Biology 2023Quote: ... we disrupted the endogenous LEU2 gene in Yα1867 yeast using the M3926 leu2::KanMX3 disruptor converter plasmid with G418 resistance (Addgene). M3926 was digested with BamHI (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... method into pDONR221 entry vector and then recombined into a yeast low-copy number CEN destination vector (Addgene, 70) to obtain pAG413-promGPD-WDR47 (pSF634) ...
-
bioRxiv - Cell Biology 2020Quote: ... endogenous SETD2 was immunoprecipitated using whole-cell extracts from HEK293T cells expressing mCherry-ACTB (Addgene plasmid #54966). Similarly ...
-
Simplified Methodology for a Modular and Genetically Expanded Protein Synthesis in Cell-Free SystemsbioRxiv - Synthetic Biology 2019Quote: The bacterial strain used for the preparation of all cell extracts is the C321ΔprfA strain (Addgene #48998) carrying a pEVOL plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... FET4 was cloned with ∼400bp of the upstream promoter into the pAG425 (resulting plasmid named pBMW182a) backbone using the Yeast Gateway System Vectors (obtained from Addgene) (Alberti et al. ...
-
bioRxiv - Genetics 2020Quote: ... These plasmids were constructed through multiple rounds of cloning using DNA fragments from yeast DNA or plasmids acquired from Addgene (kind gifts from John McCusker ...
-
bioRxiv - Immunology 2021Quote: ... Yeast scFv display libraries were generated using the amplified VH and VL DNA libraries from above and the pYD1 yeast surface display vector (Addgene plasmid #73447 ...
-
bioRxiv - Bioengineering 2023Quote: A DNA sequence encoding the CD47 Ig-like domain (Gln19 – Ser135) was cloned into the pCTCON2 yeast-surface display vector (Addgene) using the NheI and BamHI sites ...
-
bioRxiv - Bioengineering 2023Quote: ... pSNR52-BsmBI-Cj_sgRNA for gRNA expression in yeast was generated by substituting the promoter in the pU6 Cj sgRNA plasmid (Addgene 89753) with the SNR promoter by double digestion with XhoI and BamHI ...
-
bioRxiv - Systems Biology 2019Quote: ... we mixed competent yeast with promoter and GFP or mCherry PCR products and 60ng of linearized expression vector BSP188 (Addgene #110917). This expression vector contains the unc-54 terminator and chromosome II MosSCI homology arms for integration at ttTi5605 ...
-
bioRxiv - Plant Biology 2019Quote: ... ORFs of AtPIP2;5 and CA1 from the entry clones were shuttled into the galactose-inducible yeast expression plasmid pAG426GAL-ccdB (Addgene: Plasmid #1415) and pAG425GAL-ccdB (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... and subsequently assembled by yeast [Saccharomyces cerevisiae strain EBY100 (ATCC, Cat# MYA-4941)] homologous recombination with pJYDC1 plasmid (Addgene, Cat# 162458) as previously described1,5,18,19,55.
-
bioRxiv - Cell Biology 2021Quote: ... Atg18 and CSC have been C-terminally tagged with either Gly6-FLAG3::kanMX4 (available on Addgene #20754; Funakoshi et al Yeast. 2009), yomCherry::kanMX4 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmid pOsTIR1w/oGFP (for integrating the Oryza sativa TIR1 gene into the HO locus in yeast) was purchased from Addgene (Watertown, Massachusetts). pMK152 plasmid (for degron tagging CDC19 ...
-
bioRxiv - Molecular Biology 2022Quote: ... All BY4741 yeast strains used for lifespan assays and for RNA extraction were made prototrophic by transformation with the pHLUM plasmid (Addgene, Watertown, Massachusetts) (Mulleder et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All plasmids in this study were constructed using Golden Gate Assembly (Engler et al., 2008) and formatted with the Yeast MoClo Toolkit (Lee et al., 2015) (Addgene Kit #1000000061). ORFs encoding previously described zinc finger and clamp proteins (Bashor et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... To produce recombinant CK2 kinase the CKA2 gene was PCR amplified from yeast cDNA library and cloned into a pOPINF vector (a kind gift from Ray Owens, Addgene plasmid 26042) to encode a 3C-cleavable His6 fusion protein ...
-
bioRxiv - Biochemistry 2022Quote: The NLS-Keima-luciTS plasmid was constructed by replacing the GFP moeity with yeast optimized Keima using a cassette amplified from plasmid pFA6a-link-yomKeima-Kan (Addgene plasmid #44902) with the oligonucleotides 5’ATGGCTTCTCCTAAGAAGAAACGTAAAGTTATGGTTTCTGTGATCGCTAAACAAAT GAC and 5’CCATGCAAGCTTGCGCGGATCCGCGCCCTAATAGAGAATGTCTTGCGATAGC ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first replaced the SH3 domain with a flexible linker (GGSSGGGG) using yeast competent cells that were co-transformed with a pCAS plasmid (Addgene plasmid 60847) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting pENTRY-CHEK2stop-BamHI variants were then cloned into the yeast vector pAG414GAL (a gift from Susan Lindquist; Addgene plasmid # 14143) using the LR reaction ...