Labshake search
Citations for Addgene :
1 - 13 of 13 citations for GPR64 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... pLKO.1 puro GFP siRNA (Addgene, # 12273)43 ...
-
bioRxiv - Cell Biology 2021Quote: ... 40nmol siRNA and 1ug Cerulean-c1 plasmid (Addgene #54604) using electroporation (BioRad electroporator) ...
-
bioRxiv - Molecular Biology 2022Quote: ... NOL7 siRNA-resistant cDNA was subcloned into the pLX301 vector (Addgene, 25895) containing an N-terminal HA epitope tag with an LR reaction (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: The siRNA-resistant CPAP cDNA containing plasmid was obtained from Addgene (#46390). Full-length and C-terminal coding sequences (residues 895-1338 CP3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were co-transfected with siRNA and 1 µg of plasmid encoding Perceval HR (Addgene ID:49083) at around 50% cell confluency ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Cell Biology 2020Quote: Huwe1 stable knockdown: The same targeting sequences as for siRNA studies were cloned to pLKO.1 puro plasmid (Addgene 8453). As control ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Neuroscience 2020Quote: Transfection for the CD63 overexpression construct was done as described above for siRNA transfection using 2 µg/mL of CD63-pEGFP (Addgene, USA) added for 5 h in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Systems Biology 2022Quote: ... Transfection with siRNA or the RFP-tagged protein of interest was performed 12 hours prior to transfection with I-SceI (Addgene #26477) or GFP control (Addgene #89684) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequence targeting TCF4 was designed based on the sequence of the siRNA pool and cloned in a FH1 vector (Addgene Plasmid, Cat#164098).