Labshake search
Citations for Addgene :
1 - 43 of 43 citations for Dinitrophenyl beta alanyl glycyl glycine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Beta (Addgene # 170449), Gamma (Addgene # 170450) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or the human IFN-beta promoter (IFN-Beta-pGL3, Addgene #102597), renilla luciferase fused to herpes simplex virus thymidine kinase promoter (pTK-Renilla ...
-
bioRxiv - Biochemistry 2020Quote: ... DGK beta (Addgene; 35405) were from Robert Lefkowitz and Stephen Prescott ...
-
bioRxiv - Microbiology 2022Quote: ... IFN-Beta-pGL3 (Addgene 102597), or empty vector pcDNA3.1 (Life Technologies V79020 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Beta-Catenin-20 (Addgene plasmid 55001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used pLV-beta-catenin ΔN90 (Addgene, #36985) and pPRIME-CMV-NEO-recipient (CTRL ...
-
bioRxiv - Cell Biology 2024Quote: YFP NLS Beta-Actin G13R (Addgene no. 60615) was used to construct the mEos3.2 actin-G13R plasmid using SalI-HF and BamH1 to combine the mutated region of actin with existing mEos3.2 actin plasmids ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used pXL002-ishRNA-beta-catenin-1 (Addgene, #36297) and pXL004-ishRNA-scramble (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmid E[beta]C (Addgene cat. no. 24312) was used ...
-
bioRxiv - Plant Biology 2021Quote: ... coli strains containing pAC-BETA-At (Addgene plasmid no. #53288), pAC-ZETA (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mCherry-Beta-Catenin-20 (a gift from Michael Davidson; Addgene plasmid # 55001), and pcDNA3-S33Y Beta-catenin (a gift from Eric Fearon (Kolligs et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... and XE49 pt beta-catenin-myc (Xenopus β-cateninΔEX3; Addgene plasmid #16840) were a gift from Randall Moon38 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017; http://n2t.net/addgene:54017; RRID:Addgene_54017) were gifts from Michael Davidson.
-
bioRxiv - Biochemistry 2022Quote: ER-mCherry (mCh-Sec61 beta) plasmid was a gift from Gia Voeltz (Addgene 49155) (37) ...
-
bioRxiv - Microbiology 2020Quote: ... pMch-sec61-beta shows ER and the ER-Golgi intermediate compartment (Addgene cat 49155) (40) ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid pCI-neo beta catenin S33Y was a gift from Bert Vogelstein (Addgene plasmid # 16519 ...
-
bioRxiv - Immunology 2021Quote: ... MSCV-beta-catenin-IRES-GFP was a gift from Tannishtha Reya (Addgene plasmid #14717). MSCV-Cre-IRES-GFP was previously described [9] ...
-
bioRxiv - Microbiology 2024Quote: ... 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3, Addgene 102597), 5ng of renilla luciferase (pRL-TK - Promega E2241) ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Cell Biology 2021Quote: ... Reduced Expression GFP beta actin was a gift from Rick Horwitz & Tim Mitchison (Addgene plasmid # 31502). In this plasmid the base pairs 91-544 of the enhancer region in the CMV promoter are deleted ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14754). Plasmids were purified from a host E ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-WT (HA GSK3 beta wt pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14753), GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Microbiology 2022Quote: ... pCMV encoding HIV-1 Vpr fused to beta lactamase (pCMV4-BlaM-Vpr) was obtained from Addgene (21950). A plasmid encoding replication-incompetent HIV-1 lacking env and vpr and encoding luciferase (pNL4-3LucR-E- ...
-
bioRxiv - Genomics 2021Quote: ... KRAB and MeCP2 were linked to dCas9 with flexible glycine-serine linkers and cloned into lentiCas9-Blast (Addgene 52962) (22).
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613 ...
-
bioRxiv - Neuroscience 2024Quote: ... with PCR of the hDlxI56i enhancer and minimal beta globin promoter from hDlxI56i-minBglobin-iCre-4X2C (Addgene #164450). hDlxI56i eGFP plasmid was made by cutting CMV-eGFP-synapsin (Chi et al. ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid pCI-neo beta catenin S33Y was a gift from Bert Vogelstein (Addgene plasmid # 16519; http://n2t.net/addgene:16519; RRID: Addgene_l6519).
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid, 49155; http://n2t.net/addgene:49155; RRID:Addgene 49155)) with primers ATGGTGAGCAAGGGCGAGGA and TTACCCTGTCTTATTGCTAAATGGAACGTAAAAGTTAGGACCCGAACGAGTGTAC TTGCCCCAAATGTG ...
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Neuroscience 2022Quote: ... and simultaneously injected 150nL of a retrograde AAV expressing a td Tomato tag under the CAG (chicken beta-actin) promoter (rgAAV-CAG-td tomato; Addgene) (Tervo et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Genetics 2022Quote: ... 2015) flanked by 2X core sequence of the HS4 chicken beta globin insulator was cloned into a targeting vector (Addgene #92142) that contains homology arms of the mouse TIGRE genomic locus (Madisen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Cell Biology 2023Quote: ... we generated AAV8-RIP1-mCherry-EGFP-LC3B plasmid by cloning the insulin/beta globin promoter and the mCherry-EGFP-LC3B construct (from Addgene construct #22418, (28)) into an AAV8 packaging plasmid ...