Labshake search
Citations for Addgene :
1 - 21 of 21 citations for Cyanine2 NHS ester minimal dye since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... or a doxycycline-inducible minimal CMV promoter (Addgene 26431). An EGFP reporter was co-expressed with Aqp1 using an internal ribosome entry site (IRES ...
-
bioRxiv - Bioengineering 2024Quote: ... or a doxycycline-inducible minimal CMV promoter (Addgene plasmid #26431). EGFP and tdTomato were co-expressed with Aqp1 and Oatp1b3 respectively using an internal ribosome entry site (IRES ...
-
bioRxiv - Molecular Biology 2020Quote: ... contains the minimal K8.1 promoter and ORF57 Pr pGL4.16 (Addgene plasmid #120378) contains a minimal ORF57 early gene promoter and have been described previously (13) ...
-
bioRxiv - Bioengineering 2024Quote: ... with primers BW-NH-710 and BW-NH-711 while pTol2Dest was constructed by amplification of pT2/HE (Addgene Plasmid ID: 26557) with BW-NH-792 and BW-NH-793 ...
-
bioRxiv - Cancer Biology 2024Quote: ... A minimal promoter was removed from the M50 Super 8x TOPFlash (AddGene 12456) by XhoI and HindIII digest and ligated to an XhoI digested pGL3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and GFP with a minimal promoter amplified from pMPRAv3:minP-GFP (Addgene plasmid #109036) using primers MPRA_v3_GFP_Fusion_F and MPRA_v3_GFP_Fusion_R was inserted by Gibson assembly resulting in the 200 bp oligo sequence positioned directly upstream of the promoter and the 20 bp barcode falling in the 3’ UTR of GFP ...
-
bioRxiv - Genetics 2024Quote: ... and a GFP amplicon with a minimal TATA promoter (amplified from pMPRAv3:minP-GFP, Addgene #109035) was inserted using Gibson assembly (125uL 2xNEB HiFi Assembly MM ...
-
bioRxiv - Genomics 2020Quote: ... The ORI minimal promoter and flanking region was PCR amplified from the hSTARR-seq plasmid (Addgene #99296) with a custom primer that included homology for Gibson cloning and KAPA HiFi HotStart ReadyMix (Kapa KK2602 ...
-
bioRxiv - Neuroscience 2021Quote: ... consisting of seven tet operator sequences followed by the minimal CMV promoter (sequence source pCW57.1; Addgene #41393), driving the inducible expression of the downstream TDP-43-HA ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid pHAGE NFkB-TA-LUC-UBC-GFP-W containing the luciferase gene under the minimal NF-κB promoter was a gift from Darrell Kotton (Addgene plasmid #49343; http://n2t.net/addgene:49343; RRID:Addgene_49343). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2024Quote: ... with PCR of the hDlxI56i enhancer and minimal beta globin promoter from hDlxI56i-minBglobin-iCre-4X2C (Addgene #164450). hDlxI56i eGFP plasmid was made by cutting CMV-eGFP-synapsin (Chi et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... JHREs were inserted upstream of the minimal hsp70b promoter and eGFP coding sequence of pS3aG transformation vector (Addgene #31171) containing an attb for site-specific integration ...
-
bioRxiv - Neuroscience 2020Quote: ... somBiPOLES was cloned into an AAV2-backbone behind the minimal CaMKII promoter23 resulting pAAV-CaMKII-somBiPOLES-mCerulean (Addgene #154948). Double-floxed inverted open reading frame variants of BiPOLES and somBiPOLES were generated by cloning these inserts in antisense direction behind the Ef1alpha or hSyn promoter ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid pHAGE NFkB-TA-LUC-UBC-GFP-W containing the luciferase gene under the minimal NF-κB promoter was a gift from Darrell Kotton (Addgene plasmid #49343 ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... BiPOLES and somBiPOLES were cloned into an AAV2-backbone behind the minimal Dlx (mDlx) promoter15 resulting in pAAV-mDlx-BiPOLES-mCerulean (Addgene #154946) and pAAV-mDlx-somBiPOLES-mCerulean (Addgene #154947) ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Immunology 2023Quote: ... was co-transfected with a plasmid expressing the luciferase gene (Luc) under the control of the minimal promoter of the Il17a gene (minIL17prom-Luc) (Addgene, No. 20124). Transfections were performed using calcium phosphate method ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM DTT) to remove any unreacted dye and were incubated with 0.2 µM TEV protease (expressed from pRK793 (Addgene plasmid # 8827) and purified from E ...