Labshake search
Citations for Addgene :
1 - 19 of 19 citations for Biotin Rabbit Polyclonal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857 ...
-
bioRxiv - Molecular Biology 2019Quote: ... A lentivirus construct containing the biotin ligase BirA was generated from the lentiCRISPR v2 backbone (Addgene 52961)[61] and a construct containing BirA (a gift from Mauro Modesti ...
-
bioRxiv - Immunology 2020Quote: ... Polyclonal Cas9/CRISPR knockout cell lines were generated with lentiCRISPR-v2 (Addgene #52961) and selected with puromycin ...
-
bioRxiv - Cell Biology 2020Quote: ... pWC223 encoding the motor domain of Drosophila kinesin 1 fused to BCCP (noted Kin1-biotin) was a gift from Jeff Gelles (Addgene plasmid # 15960; http://n2t.net/addgene:15960; RRID:Addgene_15960).
-
bioRxiv - Molecular Biology 2023Quote: ... the ORFs were cloned into plasmid H6-mCerulean (pET Biotin His6 TEV mCerulean LIC cloning vector, Addgene plasmid #29726). In the second step ...
-
bioRxiv - Molecular Biology 2019Quote: ... 293T cells were cotransfected with vectors encoding an RNA bait flanked by BoxB stem loops and the BASU biotin ligase (Addgene #107253 and #107250 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified PCR products were fused to biotin ligases via In-Fusion Recombination into myc-BioID2 pBabe (Addgene #80900; XhoI/PmeI), BioID2-HA pBabe (Addgene #120308 ...
-
bioRxiv - Cell Biology 2020Quote: ... pWC223 encoding the motor domain of Drosophila kinesin 1 fused to BCCP (noted Kin1-biotin) was a gift from Jeff Gelles (Addgene plasmid # 15960 ...
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857; http://n2t.net/addgene:20857; RRID:Addgene_20857, Howarth et al., 2005).
-
bioRxiv - Molecular Biology 2023Quote: ... were fluorescently tagged in two steps by first cloning the ORFs into plasmid H6-mOrange (pET Biotin His6 mOrange LIC cloning vector, Addgene plasmid #29723) and then into plasmid 438B.
-
bioRxiv - Genomics 2020Quote: ... The Bassik lab gifted us K562 cells that were transduced to express dCas9-BFP-KRAB (Addgene #46911, polyclonal). The cells were grown at 37°C and cultured in RPMI 1640 with L-Glutamine (GIBCO ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids expressing murine PKA (mPKA) RIIα and ER membrane targeting signal fused miniTurbo promiscuous biotin ligase (ER-mTb) were obtained from Addgene (#45527 and #107174, respectively). The mPKA RIIα sequence was PCR amplified and cloned into the upstream of the mTb sequence ...
-
bioRxiv - Microbiology 2024Quote: HeLa-TetR-Cas9 clonal cells used in the genome-wide screen and polyclonal Huh7 cells transduced with 311-Cas9 (Plasmid Addgene #96924) and selected using 10 µg/mL blasticidin for 7 days were used for secondary screening ...
-
bioRxiv - Systems Biology 2024Quote: ... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...