Labshake search
Citations for Addgene :
401 - 450 of 2434 citations for trans 2 2 4 Bromophenyl 2 oxoethyl cyclohexane 1 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... cDNA of SKAP2WT and SKAP2W336K (see Table 2) was transferred into pLEX_307 (Addgene #41392). For analysis of subcellular localization ...
-
bioRxiv - Microbiology 2021Quote: ... The pCRISPomyces-2 vector used in this study was obtained from Addgene (Code: 617374). All the media and chemicals were used in this study were purchased from Hi-media (Mumbai-India ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×106 cells were co-transfected with Cas9 (pU6_CBh-Cas9-T2A-BFP: Addgene #64323) and gRNA (pSPgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... psiCHECK-2-Sal4-wt_3’UTR was a gift from Robert Blelloch (Addgene plasmid # 31862). psiCHECK-2-Rab GTPases were generated by inserting Rab GTPases into psiCHECK- 2-Sal4-wt_3’UTR by XhoI/NotI.Tetanus toxin light chain (Eisel et al. ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAV plasmids presented in this study are available from Addgene (Supplementary Table 2).
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 gRNA plasmids were generated per construct and were integrated into pX330 (Addgene# 42230) using BbsI site as previously described 16 ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
The HUSH epigenetic repressor complex silences PML nuclear bodies-associated HSV-1 quiescent genomesbioRxiv - Microbiology 2024Quote: ... plasmids of interest (see plasmids section) were co-transfected with psPAX.2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2024Quote: ... gRNA#2: ATGTTGGCTAGCTGTCGATT (Exon2 ORF bp196-215) and cloned into lentiCRISPRv1 (Addgene, plasmid 49535). After lentiviral transduction using lentiCRISPRv1 as control as described below ...
-
bioRxiv - Neuroscience 2024Quote: ... For calcium imaging an AAV was injected (AAV1.Syn.GCaMP6m.WPRE.SV40; RRID: Addgene_100841, titre: 2*1012) into the PPC (from Bregma ...
-
bioRxiv - Immunology 2024Quote: ... The wild-type SARS-CoV-2 spike plasmid (HDM-SARS2-spike-delta21, Addgene #155130) was cloned with the additional D614G substitution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Vector for CRISPR/Cas9-mediated knock-out of BCL-2 was plentiCTRSPRv2 (Addgene #52961) with gRNA targeting exon 1 in BCL2 ...
-
bioRxiv - Plant Biology 2024Quote: ... a level 2 receiver plasmid was constructed by assembling a 35S promoter (Addgene #54406), a LacZ expression cassette flanked by Esp3I sites (Addgene #54458) ...
-
bioRxiv - Genomics 2024Quote: ... / and (2) CRISPR-Cas9 vectors containing gRNA sequence for TP53 (Addgene, Cat No.121917) were purchased from Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mixture of AAV2-retro-EF1a-Flpo (Addgene #55637, 2 × 1013 vg/mL) and AAV5-CAG-DIO-ArchT-tdTomato (2 × 1012 gc/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... The wild-type SARS-CoV-2 spike plasmid (HDM-SARS2-spike-delta21, Addgene #155130) was cloned with the additional D614G substitution ...
-
bioRxiv - Cancer Biology 2024Quote: ... identical inocula contained 2 μg of Crispr/Cas9 pDG458 vectors (Addgene, Inc., Watertown, MA), each of which encoded gRNAs against 2 regions of the Cdkn2a exon 2 gene locus (Table 2 and Figure 1) ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S / HIV-1 pseudotyped viruses were packaged by co-transfecting a lentiviral construct pHIV-Luciferase (Addgene plasmid # 21375), a packaging construct psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Neuroscience 2024Quote: ... and two sgRNA targeting sequences against BORCS7 (1: CGCGATTACGTCAGTACCAC, 2: GATTACGTCAGTACCACAGG) were cloned into the lenti-CRISPR v2 plasmid (Addgene 52961) following the Zhang Lab protocol (https://media.addgene.org/data/plasmids/52/52961/52961-attachment_B3xTwla0bkYD.pdf) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-hSyn-GRABNE2h was co- injected with AAV9-CAG-tdTomato (stocks at 1-2 x 1013 copies/mL, Addgene, #59462-AAV9).
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...