Labshake search
Citations for Addgene :
201 - 250 of 1338 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Cell Biology 2024Quote: ... multiple CRISPR single-guide RNAs against the sequence 5′-CAGCGGCAAGGACCAGACCG-3′ or 5′-CAGCGGCAAGGACCAGACCG-3′ were cloned into puromycin-resistant pLenti-CRISPRV2 (Addgene; Cat# 49535) which was transfected into 293TN cells with psPAX3 and pCMV-VSV-G (a gift from Jan Lammerding ...
-
bioRxiv - Immunology 2022Quote: ... The Vκ1-33/CBE replacement of Vκ3-2 was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and two guide RNAs that target the mouse Vκ3-2 segment ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332).
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5 µg of Cas9-GFP plasmid (Addgene, 44719), 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μg of either H2B-GFP (Addgene #11680) or H2B-RFP (Addgene #26001 ...
-
bioRxiv - Systems Biology 2023Quote: ... The CRISPRi-v2 (5 sgRNA/TSS, Addgene: Cat#83969) sgRNA library was transduced into Jurkat cells at an MOI < 0.3 (BFP+ cell percentages were ∼30%) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 5×NF-κB_RE::RedF (#124530; Addgene, Watertown, MA, USA) is the reporter plasmid consisting of a red firefly luciferase driven by a minimal promoter containing five NF-κB-binding sites (NF-κB-Luc ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg of phCMV-VSV-G (#8454 Addgene) using calcium phosphate transfection kit (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Microbiology 2022Quote: pCMV-GFP-SARS-CoV-ORF3a was generated by recombining the SARS-CoV-2-ORF3a coding sequence (pDONR207 SARS-CoV-2 ORF3aA, #141271, Addgene) into pDEST-CMV-N-EGFP (#122842 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Microbiology 2022Quote: UAS-SARS-CoV-2-ORF3a transgenic flies were generated by PCR-mediated subcloning of the SARS-CoV-2-ORF3a coding sequence (pDONR207-SARS-CoV-2 ORF3a, #141271, Addgene) into pUASt-Attb (EcoRI/XbaI) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Microbiology 2024Quote: The following open reading frames were cloned into an expression vector under the control of the phosphoglycerate kinase promoter: IKK-2 and its mutant IKK-2 K44M (Addgene plasmids #11103 and #11104 ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... and pmNG-Mpro-NLuc-PLpro-mScarlet either alone or co-transfected with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with DuProSense biosensor containing Mpro cleavage sites and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid along with pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gRNAs 1 and 2 (Supplemental Table 2) were cloned into the pSpCas9n(BB)-2A-Puro (PX462) V2.0 plasmid (Addgene 62987) as described previously70 ...
-
bioRxiv - Biophysics 2024Quote: ... equal amounts of both pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...