Labshake search
Citations for Addgene :
151 - 200 of 3143 citations for tert Butyl N 1 methyl 2 oxo 3 pyridyl methyl carbamate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Biochemistry 2020Quote: ... according to manufacturer’s instruction and then transferred to pLX302 lentiviral destination vector (addgene) or pDEST-CMV-N-EGFP vector (pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842) using recombination utilising the LR-Clonase (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... A PCUP1 N-ubiquitin plasmid was constructed by amplifying the CUP1 promoter through N-ubiquitin sequence from the integrating plasmid (Addgene 131169, [56]) and gap repairing it into pRS315 linearized with BamHI ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Immunology 2024Quote: ... and pGEX-4T2-14-3-3 tau (θ) (Addgene #13281) were gifts from Michael Yaffe (Yaffe et al ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Biophysics 2021Quote: ... was fused on the N-terminus of hCdt1 (Addgene #80007 ...
-
bioRxiv - Biophysics 2022Quote: ... N-terminal hexahistidine tag fused construct (Addgene plasmid #98669) with a tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus glutathione S-transferase (GST; RRID:Addgene_29707); N-terminal His6 plus small ubiquitin-like modifier (SUMO ...
-
bioRxiv - Microbiology 2023Quote: ... were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223) by Gateway cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... mVenus-Integrin-Beta1-N-18 plasmid (Addgene plasmid #56330) was obtained from Addgene (USA) ...
-
bioRxiv - Bioengineering 2023Quote: ... n×GCN4 sequences were derived from plasmid (Addgene #113022) via PCR ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... we used Cbh_v5 AAV-ABE N-terminal (Addgene: 137177) and Cbh_v5 AAV-ABE C-terminal (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... N-WASP cDNA was purchased from Addgene (plasmid #33019), PCR amplified and ligated into pEGFP-C1 plasmid using XhoI and EcoRI restrictions sites ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.75 µL of rgAAV-FLEX-tdTomato (diluted 1:3 in dPBS; Addgene number: 28306) was injected in TH-Cre mice in basal forebrain (AP ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh2: 5-CCAACAACATCTTCTGCTCC-3’ were cloned into the lentiviral vector pLKO.1 (Addgene #8453)[16] ...
-
bioRxiv - Genomics 2022Quote: ... gRNAs were constructed from pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP (Addgene 84254) and pSLQ1852-2 pHR ...
-
bioRxiv - Neuroscience 2024Quote: ... cohort 1) or AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2).
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Microbiology 2024Quote: ... BHK-21/WI-2 cells were infected with vTF7-3 for 45 min and then transfected with pVSV-EGFP-dG (Addgene 31842) or pVSV-FLuc-dG and pBS vectors encoding the N ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 (sgRNA-GALC2: 5’ TACGTGCTCGACGACTCCGA 3’) were subcloned individually into pX459 v2.0 (gift from Dr. Feng Zhang, Addgene plasmid #6298832). GALC targeting sequences were further tested by the Off-Spotter software to minimize potential off target effect ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.6-0.8 uL of a 1:1 mixture of GAD1-cre and mCherry virus (AAV8-hSyn-DIO-mCherry, ≥ 1×101 3 vg/mL; Addgene, Watertown, MA, USA) was injected bilaterally into VP ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000 ng frame selector (pCAS9-mCherry-Frame +0/+1/+2, Addgene plasmid #66939/#66940/#66941 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-M-2×Strep-IRES-Puro(Addgene#141386, Wuhan-Hu-1) with NotI/BamHI- ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-E-2×Strep-IRES-Puro (Addgene#141385, Wuhan-Hu-1), pLVX-M-2×Strep-IRES-Puro(Addgene#141386 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Microdomain targeting was accomplished using N-terminal fusions of tags to the matrix using 2xCOX8A (tag corresponds to Cox8A N-terminal residues 1-25, from Addgene 136470), the IMS using SMAC (residues 1-59 ...
-
bioRxiv - Developmental Biology 2023Quote: 2.5×105 hESCs (AIC-hESCs or AIC-N hESCs) were electroporated with 1 μg of donor plasmid AAVS1-CAG-hrGFP (Addgene, #52344) or AAVS1-Pur-CAG-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Biochemistry 2024Quote: ... An oligonucleotide corresponding to a target sequence near the smo-1 translational start site (sgRNA #1: 5‘ GCCGATGATGCAGCTCAAGC 3‘) was cloned into the plasmid pMW46 (derivate of pDD162 from Addgene). The deletion of the eleven amino acids ADDAAQAGDNA at the SMO-1 N-terminus was achieved using the oligonucleotide pAF64 as repair template ...
-
bioRxiv - Biophysics 2024Quote: The genes encoding for full-length and truncated versions of N-protein (Uniprot: P0DTC9) were PCR-amplified from a vector with the cDNA of N-protein acquired from Addgene (pGBW-m4046785; Plasmid #145684). The CC null mutants in which L223 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756) was utilized as the backbone for recombinant protein expression E ...