Labshake search
Citations for Addgene :
51 - 100 of 1658 citations for R 4 Benzyl 2 2 diphenylphosphino benzyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... the cells were reprogrammed by a mixture of retroviral vectors encoding OCT3/4 (pMXs-hOCT3/4 Addgene: 17217), SOX2 (pMXs-hSOX2 Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
An improved TEAD dominant-negative protein inhibitor to study Hippo YAP1/TAZ-dependent transcriptionbioRxiv - Cell Biology 2024Quote: ... pcDNA3-HA-TAZ 39 and pCMX-GAL4-TEAD1 to 4 5 constructs were a gift from Kunliang Guan (Addgene plasmids 32839 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 × 105 cells were resuspended in 10 μL of R-buffer with 0.5–2 μg of the EMTB 3x EGFP plasmid (a gift from William Bennett, Addgene plasmid 26741). Cells were exposed to three pulses of amplitude 1325 V and duration 10 ms in the electroporator ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg psPAX2 packing plasmid (Addgene, 12260), and 0.8 μg pMD2.G envelope plasmid (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLS-hOCT3/4 (Addgene plasmid #27076) episomal vectors (Okita et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of psPAX2 (Addgene plasmid # 12260), and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg hCas9 D10A (Addgene plasmid #41816) (Mali et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Insulin in pX330S-4 (Plasmid #58780, Addgene) and Glut2 in pX330S-5 (Plasmid #58781 ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/2 (Addgene, ref# 104963), AAV-GFP/Cre (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: The gcy-8p::gfp::egl-4 plasmid was constructed by replacing the promoter in the odr-3p::gfp::egl-4 plasmid (Addgene) with the AFD-specific gcy-8 promoter using standard restriction enzyme-mediated cloning ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536) plasmids (Ngondo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (#27078) ...
-
bioRxiv - Bioengineering 2022Quote: ... respectively (Supplementary Data 4, Addgene #183903 and #183904). For piggyBac integration near the Ae ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg of pCMV-VSV-G (Addgene #8454) and 7.5 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 µg of psPAX2 (Addgene, cat# 12260) using Lipofectamine 2000 Transfection Reagent according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 µg of pVSV-G (Addgene, Plasmid #8454), and 10 µg of lentiviral plasmid of interest were used ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 injections of 5µl of AAV PHP.S (Addgene, 28306-PHP.S ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 W276A/I279A/I307A/V310A (ΔLIR1+4) (RRID:Addgene_223755), BCL2L13 I224A/L227A/W276A/I279A/I307A/V310A (ΔLIR1+3+4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Individual sgRNAs targeting sites 1-4 of the SABER array were cloned into 4 separate U6x:sgRNA plasmids (Addgene plasmids 64245-64248) as described previously52 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Cell Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Genetics 2021Quote: ... PiggyBac cargo plasmids used in Figure 3 and shown in Extended Data Figure 3 and pegRNA-expressing plasmids used in Figure 4 and Extended Data Figure 4 were created using the Mammalian Toolkit (Addgene article #2819751028), which was a gift from Hana El-Samad (UCSF).
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...