Labshake search
Citations for Addgene :
751 - 800 of 856 citations for 2S 2 Boc amino undecanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... vectors encoding a nitrate-responsive green luciferase (AtNRPP-Eluc-Hsp18-2) and constitutively-expressed red luciferase (pNOS-Rluc-tNOS; pGREAT27, Addgene #170915) are delivered to root protoplasts ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293 cells were transfected with a mixture of the 3rd generation lentiviral packaging plasmids containing: 2 μg of Rev (pRSV-Rev, Addgene #12253), 2 μg of Gag and Pol (pMDLg/pRRE ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Genomics 2023Quote: ... the entry vector was constructed by adding a bcl-2 splice acceptor and four SV40 polyA-signals to a plasmid backbone based on pSMART (Addgene #49157) containing a green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct encoding SARS-CoV-2 matrix (M) protein was cloned by PCR amplification of M cDNA from the pDONR 207 SARS-CoV-2 M plasmid (Addgene #141274) using a Forward primer inserting a restriction site for EcoRI and a reverse primer bearing a restriction site for BamHI and a Myc tag ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Microbiology 2023Quote: IDT gBlock gene fragments encoding WT and mutant SARS-CoV-2 Mac1 were cloned into a BamHI- and EcoRI-linearized pLVX-EF1alpha-nCoV2019-nsp13-2xStrep-IRES-Puro (Addgene, 141379) by Gibson Assembly Cloning reaction (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... self-complementary single-stranded DNA oligos (Supplementary Table 2) were annealed and cloned into AgeI/EcoRI sites of Tet-pLKO-puro vector (Addgene, #21915). Tet-pLKO-puro vectors were packaged into a lentivirus system with pCMV-VSV-G (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... We expressed the soma-targeted opsin ST-ChrimsonR 43 in excitatory neurons by injecting a virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) into the craniotomy ...
-
bioRxiv - Neuroscience 2023Quote: Viral injections were performed postnatally at P1-2 with in-house produced according to or commercially available viral vectors AAV-php.eB-hSyn-gCamp7f (Addgene Plasmid #104488) or AAV-php.eB-S5E2-ChR2-mCherry (Addgene Plasmid #135634 ...
-
bioRxiv - Microbiology 2023Quote: ... and pRN-Luc (50 ng) reporter plasmids in combination with S protein expressing plasmids pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Bioengineering 2024Quote: An all-in-one Cas9/gRNA expression construct encoding an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene; 129727) was placed downstream of the hU6 promoter in a PX458 (Addgene ...
-
bioRxiv - Biophysics 2024Quote: ... the HECT domain consisting of residues 615-994 of full-length NEDD4-2 (a gift from Joan Massague, Addgene plasmid # 27000) (66 ...
-
bioRxiv - Biochemistry 2024Quote: Mutations of phosphorylation sites within the SR region were generated via site-directed mutagenesis based on either the tag-free SARS-CoV-2 Nucleocapsid protein plasmid (Addgene, #177937) or the Strep-tagged SARS-CoV-2 Nucleocapsid protein plasmid (Dr ...
-
bioRxiv - Microbiology 2024Quote: ... BHK-21/WI-2 cells were infected with vTF7-3 for 45 min and then transfected with pVSV-EGFP-dG (Addgene 31842) or pVSV-FLuc-dG and pBS vectors encoding the N ...
-
bioRxiv - Molecular Biology 2024Quote: ... and SARS-CoV-2 nsP3 Mac1 (Kind gift by Sarah Knapp, RWTH Aachen) were subcloned into a Sleeping Beauty vector (Addgene #60506). The Sleeping Beauty vector was co-transfected with a Sleeping Beauty Transposase (Addgene #34879 ...
-
bioRxiv - Neuroscience 2024Quote: ... EnvA-N2C-dG-tdTomato (2×109, Center for Neuroanatomy with Neurotropic Viruses, CNNV)m AAV9-hSyn-DIO-hM4d(Gi)-mCherry (Addgene #44362)32 ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Genetics 2024Quote: Two sgRNAs targeting the start and end of the rme-2 coding sequence were in vitro transcribed from a SP6 transcription template amplified from pDD162 (Addgene #47549) using primers P42 (start sgRNA ...
-
bioRxiv - Molecular Biology 2024Quote: RIF1-/- and RIF1ΔEx32 cells were generated by transient transfection of U-2 OS cells with pX459 vectors (v2, Addgene plasmid #62988) 30,31 harboring two sgRNA sequences targeting RIF1-Ex2 (5’-CACCgAGTCTCCAACAGCGGCGCGA-3’ and 5’-AAACTCGCGCCGCTGTTGGAGACTc-3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... and two sgRNA targeting sequences against BORCS7 (1: CGCGATTACGTCAGTACCAC, 2: GATTACGTCAGTACCACAGG) were cloned into the lenti-CRISPR v2 plasmid (Addgene 52961) following the Zhang Lab protocol (https://media.addgene.org/data/plasmids/52/52961/52961-attachment_B3xTwla0bkYD.pdf) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-hSyn-GRABNE2h was co- injected with AAV9-CAG-tdTomato (stocks at 1-2 x 1013 copies/mL, Addgene, #59462-AAV9).
-
bioRxiv - Cancer Biology 2024Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... a small volume of AAV8-hSyn-DIO-hM3D(Gq)-mCherry virus (Addgene 44361, final titer 2 x 1012 pp per mL) was injected bilaterally into RSC (AP ...
-
bioRxiv - Synthetic Biology 2024Quote: The sgRNA oligonucleotides targeting human RAI1 promoter regions were designed using the Benchling gRNA Design Tool.39 The sadCas9-2 × VP64 vector (Addgene #135338)40 was used as a backbone vector ...
-
bioRxiv - Genetics 2024Quote: ... A synthetic gene fragment containing the anti-CRISPR AcrIIa4 codon-optimized for Drosophila was attached downstream of the ϕC31[2] integrase (from pBS130, Addgene # 26290) followed by a P2A site ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid # 19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 (sgRNA-GALC2: 5’ TACGTGCTCGACGACTCCGA 3’) were subcloned individually into pX459 v2.0 (gift from Dr. Feng Zhang, Addgene plasmid #6298832). GALC targeting sequences were further tested by the Off-Spotter software to minimize potential off target effect ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid #19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviral transduction of H7536 thyroid cancer cells was performed as described (32) to express MAX ORF Isoform 2 (NM_145112.2) that was cloned into pCW57-RFP-P2A-MCS (Addgene plasmid no. 78933).
-
bioRxiv - Developmental Biology 2024Quote: ... DICE system was introduced into the H11 locus of NKX2-5eGFP/w using 2 plasmids: one carrying Cas9 nuclease and two guide RNAs (Addgene#164850) and a second one carrying a landing pad (Addgene #51546 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sense and antisense double strands of the targets A and B (see Supplementary Table 2) were cloned into pU6-BbsI-chiRNA (Addgene #45946) [47] for production of single stranded guide RNAs (sgRNAs ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...
-
bioRxiv - Molecular Biology 2021Quote: ... sgRNA against exon 23 (Table 2) was cloned downstream of the U6 promoter of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene plasmid # 48138) 61 ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dUP-Cd63 and dUP-Myt1l (2 mg/ml, subcloned from double UP mClover to Scarlet, Addgene #125134, Taylor et al., BioRxiv 2019); DFRS ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Cell Biology 2021Quote: ... LifeAct mScarlet cell lines were generated by electroporating 2 μg/ml of pLifeAct-mScarlet-N1 plasmid DNA (a gift from Dorus Gadella, Addgene plasmid 85054) into WT and CD56-KO NK92 cells using the Amaxa nucleofector (Kit R ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6J mice received unilateral injections of AAVrg-CaMKIIα-mCherry (200 nl at 200 nl/min, titer 2×1013 vg/ml, #114469-AAVrg, Addgene, MA, USA) into the right main OB (0.5 mm lateral from midline ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 EV or g1-2 SNAP-GLP-1R cells were transfected with the pCI HA NEDD4 construct (a gift from Prof. Joan Massague, Addgene plasmid #27002) 24 hours before the experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The S1R-Apex and GFP-Apex plasmids were co-transfected into either HeLa cells (ATCC; CCL-2) or HEK293T cells (ATCC; CRL-3216) along with pXAT2 (Addgene plasmid 80494) (30) ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...